Incidental Mutation 'R7737:Arvcf'
ID596345
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Namearmadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18348182-18407076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18397101 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 119 (R119Q)
Ref Sequence ENSEMBL: ENSMUSP00000087562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090103] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000232025]
Predicted Effect probably damaging
Transcript: ENSMUST00000090103
AA Change: R119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: R119Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115610
AA Change: R55Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325
AA Change: R55Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115612
AA Change: R119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: R119Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115613
AA Change: R119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: R119Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115614
AA Change: R119Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: R119Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150253
AA Change: R55Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232025
AA Change: R55Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18403900 missense probably damaging 1.00
IGL02901:Arvcf APN 16 18398242 missense probably damaging 0.99
IGL03218:Arvcf APN 16 18404125 splice site probably benign
IGL03239:Arvcf APN 16 18397067 missense probably damaging 1.00
PIT4466001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
PIT4472001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
R0045:Arvcf UTSW 16 18403458 missense probably benign 0.40
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0873:Arvcf UTSW 16 18400205 nonsense probably null
R1227:Arvcf UTSW 16 18389304 missense probably benign 0.00
R1495:Arvcf UTSW 16 18389386 missense probably damaging 0.96
R1717:Arvcf UTSW 16 18401569 missense possibly damaging 0.52
R2021:Arvcf UTSW 16 18399732 missense probably damaging 1.00
R3873:Arvcf UTSW 16 18403033 missense probably damaging 1.00
R4095:Arvcf UTSW 16 18401577 missense probably damaging 1.00
R4280:Arvcf UTSW 16 18397991 missense probably damaging 1.00
R4496:Arvcf UTSW 16 18405182 missense probably damaging 0.96
R4887:Arvcf UTSW 16 18398113 nonsense probably null
R5068:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5069:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5070:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5322:Arvcf UTSW 16 18397643 missense probably benign 0.00
R5400:Arvcf UTSW 16 18399070 missense probably benign 0.17
R6376:Arvcf UTSW 16 18405132 missense probably damaging 0.98
R6771:Arvcf UTSW 16 18403864 missense probably benign
R7106:Arvcf UTSW 16 18399049 missense probably damaging 0.99
R7176:Arvcf UTSW 16 18399727 missense probably damaging 1.00
R7202:Arvcf UTSW 16 18405198 missense probably damaging 1.00
R7412:Arvcf UTSW 16 18401600 missense probably benign 0.03
R7783:Arvcf UTSW 16 18389198 missense probably benign 0.30
Z1088:Arvcf UTSW 16 18402641 missense probably damaging 1.00
Z1177:Arvcf UTSW 16 18389299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCCCAGTTTGAGGAAC -3'
(R):5'- GTTTGGTGGCTCTAGAGAACAAG -3'

Sequencing Primer
(F):5'- TGAGGAACTGATAACTCCTGCTCAG -3'
(R):5'- CTCTAGAGAACAAGATCGGTGCC -3'
Posted On2019-11-26