Incidental Mutation 'R7737:Slc22a27'
ID596350
Institutional Source Beutler Lab
Gene Symbol Slc22a27
Ensembl Gene ENSMUSG00000067656
Gene Namesolute carrier family 22, member 27
SynonymsmOAT6 related protein, AB056442
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7864388-7966027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7896762 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 316 (M316K)
Ref Sequence ENSEMBL: ENSMUSP00000093991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075619] [ENSMUST00000182102]
Predicted Effect probably damaging
Transcript: ENSMUST00000075619
AA Change: M316K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093991
Gene: ENSMUSG00000067656
AA Change: M316K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.5e-25 PFAM
Pfam:MFS_1 140 372 1.3e-15 PFAM
Pfam:MFS_1 349 549 8.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182102
AA Change: M208K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138475
Gene: ENSMUSG00000067656
AA Change: M208K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 241 441 1.2e-11 PFAM
Meta Mutation Damage Score 0.2312 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Slc22a27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Slc22a27 APN 19 7909743 missense possibly damaging 0.93
IGL02516:Slc22a27 APN 19 7864811 missense probably damaging 0.99
IGL02961:Slc22a27 APN 19 7926521 missense probably damaging 0.99
IGL03008:Slc22a27 APN 19 7909702 missense possibly damaging 0.92
PIT4544001:Slc22a27 UTSW 19 7909738 missense probably damaging 1.00
R0172:Slc22a27 UTSW 19 7865836 nonsense probably null
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0234:Slc22a27 UTSW 19 7926791 start gained probably benign
R0280:Slc22a27 UTSW 19 7896822 nonsense probably null
R0561:Slc22a27 UTSW 19 7880162 critical splice donor site probably null
R0597:Slc22a27 UTSW 19 7865884 missense probably benign 0.00
R1005:Slc22a27 UTSW 19 7926751 missense probably damaging 1.00
R1165:Slc22a27 UTSW 19 7909694 intron probably null
R1217:Slc22a27 UTSW 19 7926668 missense probably benign 0.01
R1533:Slc22a27 UTSW 19 7866983 missense possibly damaging 0.79
R1940:Slc22a27 UTSW 19 7909727 missense probably damaging 1.00
R3714:Slc22a27 UTSW 19 7926450 missense possibly damaging 0.75
R3959:Slc22a27 UTSW 19 7910049 missense probably damaging 1.00
R4059:Slc22a27 UTSW 19 7879608 splice site probably benign
R4249:Slc22a27 UTSW 19 7925879 missense possibly damaging 0.64
R4748:Slc22a27 UTSW 19 7925876 missense probably benign
R5220:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5221:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5232:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5330:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5331:Slc22a27 UTSW 19 7879455 missense probably benign 0.13
R5345:Slc22a27 UTSW 19 7865938 missense probably damaging 0.96
R5427:Slc22a27 UTSW 19 7879388 critical splice donor site probably null
R5534:Slc22a27 UTSW 19 7926631 missense probably damaging 1.00
R5691:Slc22a27 UTSW 19 7926670 missense possibly damaging 0.90
R5828:Slc22a27 UTSW 19 7926402 missense probably damaging 1.00
R5878:Slc22a27 UTSW 19 7926757 missense probably benign 0.01
R5918:Slc22a27 UTSW 19 7910046 missense possibly damaging 0.91
R6185:Slc22a27 UTSW 19 7926588 missense probably benign 0.14
R6901:Slc22a27 UTSW 19 7926579 missense probably damaging 1.00
R7139:Slc22a27 UTSW 19 7926547 missense probably damaging 1.00
R7336:Slc22a27 UTSW 19 7926689 missense probably benign 0.02
R7502:Slc22a27 UTSW 19 7926382 missense probably damaging 1.00
R7556:Slc22a27 UTSW 19 7865754 missense probably damaging 0.98
R7860:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R7943:Slc22a27 UTSW 19 7910107 critical splice acceptor site probably null
R8050:Slc22a27 UTSW 19 7880167 missense probably benign 0.18
R8150:Slc22a27 UTSW 19 7910025 missense possibly damaging 0.87
RF012:Slc22a27 UTSW 19 7926584 missense probably benign 0.07
Z1177:Slc22a27 UTSW 19 7909730 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAATGAAATCCTCTGCAGAAG -3'
(R):5'- GTGGCTAAATCATTCCTCACATC -3'

Sequencing Primer
(F):5'- CCTCTGCAGAAGAATTTTACAAACTG -3'
(R):5'- GGCTAAATCATTCCTCACATCTAATG -3'
Posted On2019-11-26