Incidental Mutation 'R7738:Rfx8'
ID596356
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39682931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 298 (T298K)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect probably damaging
Transcript: ENSMUST00000151913
AA Change: T298K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: T298K

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R2960:Rfx8 UTSW 1 39682952 missense probably damaging 1.00
R4554:Rfx8 UTSW 1 39680940 missense probably benign 0.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6238:Rfx8 UTSW 1 39670394 missense probably damaging 0.96
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCCTGTGTAGAGAGCAGAGATG -3'
(R):5'- TCCCTAAGCCACTGGGAAAG -3'

Sequencing Primer
(F):5'- CAGAGATGGCTGGAGCTTTTCAG -3'
(R):5'- CCACTGGGAAAGAAGCTGGC -3'
Posted On2019-11-26