Incidental Mutation 'R7738:Kat14'
ID596360
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Namelysine acetyltransferase 14
SynonymsD2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location144368983-144407676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144394242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 509 (D509G)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
Predicted Effect probably damaging
Transcript: ENSMUST00000028911
AA Change: D509G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: D509G

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147747
AA Change: D298G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425
AA Change: D298G

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156410
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCACACTAGAGCTCGAG -3'
(R):5'- TCTCCCCAGATTGCTCACAATG -3'

Sequencing Primer
(F):5'- TCTGCACACTAGAGCTCGAGAAAAG -3'
(R):5'- CAGATTGCTCACAATGACAAATGTC -3'
Posted On2019-11-26