Incidental Mutation 'R7738:Zfp518b'
ID596367
Institutional Source Beutler Lab
Gene Symbol Zfp518b
Ensembl Gene ENSMUSG00000046572
Gene Namezinc finger protein 518B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location38668484-38684826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38672187 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 825 (T825I)
Ref Sequence ENSEMBL: ENSMUSP00000137381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057258] [ENSMUST00000178760] [ENSMUST00000179555] [ENSMUST00000180214]
Predicted Effect probably benign
Transcript: ENSMUST00000057258
AA Change: T825I

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061753
Gene: ENSMUSG00000046572
AA Change: T825I

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178760
Predicted Effect probably benign
Transcript: ENSMUST00000179555
AA Change: T825I

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137381
Gene: ENSMUSG00000046572
AA Change: T825I

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180214
SMART Domains Protein: ENSMUSP00000136948
Gene: ENSMUSG00000046572

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Zfp518b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfp518b APN 5 38673766 missense possibly damaging 0.58
IGL01096:Zfp518b APN 5 38672788 missense probably benign 0.01
IGL02150:Zfp518b APN 5 38673343 missense probably damaging 1.00
IGL02150:Zfp518b APN 5 38673789 missense probably damaging 1.00
IGL02491:Zfp518b APN 5 38673780 missense possibly damaging 0.90
IGL02643:Zfp518b APN 5 38674155 missense probably damaging 1.00
IGL02710:Zfp518b APN 5 38672718 missense probably damaging 1.00
R0134:Zfp518b UTSW 5 38674659 start codon destroyed probably null 0.92
R0284:Zfp518b UTSW 5 38671740 missense probably damaging 1.00
R0308:Zfp518b UTSW 5 38672770 missense possibly damaging 0.64
R0421:Zfp518b UTSW 5 38674575 missense probably damaging 1.00
R0613:Zfp518b UTSW 5 38673603 missense probably damaging 1.00
R1604:Zfp518b UTSW 5 38673606 missense probably damaging 1.00
R1649:Zfp518b UTSW 5 38671881 missense probably damaging 1.00
R1845:Zfp518b UTSW 5 38671741 missense probably damaging 0.97
R1853:Zfp518b UTSW 5 38673407 missense probably benign 0.00
R2015:Zfp518b UTSW 5 38672002 missense probably benign 0.00
R2256:Zfp518b UTSW 5 38671636 missense possibly damaging 0.90
R3687:Zfp518b UTSW 5 38674112 missense probably damaging 1.00
R4275:Zfp518b UTSW 5 38671728 missense probably damaging 1.00
R4600:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4603:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4739:Zfp518b UTSW 5 38674498 missense possibly damaging 0.89
R5519:Zfp518b UTSW 5 38674098 missense probably damaging 1.00
R6827:Zfp518b UTSW 5 38671539 missense probably damaging 1.00
R6982:Zfp518b UTSW 5 38672905 missense probably benign 0.00
R7263:Zfp518b UTSW 5 38672328 missense probably damaging 1.00
R7271:Zfp518b UTSW 5 38674564 missense probably benign 0.01
R7354:Zfp518b UTSW 5 38682779 start gained probably benign
R7554:Zfp518b UTSW 5 38673072 missense probably damaging 1.00
R7817:Zfp518b UTSW 5 38672398 missense not run
Z1088:Zfp518b UTSW 5 38674293 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGGAGTCACTGCTTCCTG -3'
(R):5'- GCAGGTCTGTCCCCAGTTTATC -3'

Sequencing Primer
(F):5'- TGGTGCCGTGCTGTACAC -3'
(R):5'- CCCCAGTTTATCAGTGCTAATGATGG -3'
Posted On2019-11-26