Incidental Mutation 'R7738:Vmn1r28'
ID596370
Institutional Source Beutler Lab
Gene Symbol Vmn1r28
Ensembl Gene ENSMUSG00000115705
Gene Namevomeronasal 1 receptor 28
SynonymsV1rc25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location58262037-58275639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58266054 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 294 (M294T)
Ref Sequence ENSEMBL: ENSMUSP00000153799 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000226813
AA Change: M294T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227805
AA Change: M294T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228678
AA Change: M294T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Vmn1r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Vmn1r28 APN 6 58265191 missense possibly damaging 0.76
IGL01712:Vmn1r28 APN 6 58265408 missense probably benign 0.00
IGL01788:Vmn1r28 APN 6 58265537 missense probably benign 0.00
IGL02629:Vmn1r28 APN 6 58265816 missense probably benign 0.00
R0001:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0009:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0040:Vmn1r28 UTSW 6 58265894 missense probably damaging 1.00
R0078:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0079:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0081:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0164:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0165:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0166:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0167:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0172:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0173:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0284:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0288:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R0704:Vmn1r28 UTSW 6 58265717 missense probably benign 0.00
R1143:Vmn1r28 UTSW 6 58265742 missense probably benign 0.00
R1225:Vmn1r28 UTSW 6 58265966 nonsense probably null
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1464:Vmn1r28 UTSW 6 58265232 missense probably benign 0.05
R1836:Vmn1r28 UTSW 6 58265252 missense probably damaging 0.98
R1882:Vmn1r28 UTSW 6 58265978 missense probably benign
R1905:Vmn1r28 UTSW 6 58265927 missense probably benign 0.01
R4912:Vmn1r28 UTSW 6 58265540 missense possibly damaging 0.86
R5071:Vmn1r28 UTSW 6 58265909 missense probably benign 0.25
R5113:Vmn1r28 UTSW 6 58265858 missense probably benign 0.12
R5261:Vmn1r28 UTSW 6 58265539 missense probably benign 0.02
R5265:Vmn1r28 UTSW 6 58265964 missense probably damaging 0.98
R5839:Vmn1r28 UTSW 6 58265295 missense possibly damaging 0.94
R6180:Vmn1r28 UTSW 6 58265491 missense probably damaging 0.99
R6643:Vmn1r28 UTSW 6 58265960 missense probably benign 0.17
R6884:Vmn1r28 UTSW 6 58265648 missense probably benign 0.03
R7393:Vmn1r28 UTSW 6 58265589 missense possibly damaging 0.81
R7471:Vmn1r28 UTSW 6 58265865 nonsense probably null
R8009:Vmn1r28 UTSW 6 58265193 missense probably benign
R8156:Vmn1r28 UTSW 6 58265198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACCATCTTGCTGTTGG -3'
(R):5'- CCTCAGCATCAAGGACACTTCTAAG -3'

Sequencing Primer
(F):5'- CAGACCATCTTGCTGTTGGTAGTG -3'
(R):5'- TGCTGTACAATGAACTTGAGAAG -3'
Posted On2019-11-26