Incidental Mutation 'R7738:Vmn1r177'
ID596371
Institutional Source Beutler Lab
Gene Symbol Vmn1r177
Ensembl Gene ENSMUSG00000057513
Gene Namevomeronasal 1 receptor 177
SynonymsV1rd12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23865520-23866449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23866134 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000073621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073967]
Predicted Effect probably damaging
Transcript: ENSMUST00000073967
AA Change: T106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073621
Gene: ENSMUSG00000057513
AA Change: T106A

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 4.1e-13 PFAM
Pfam:V1R 41 297 5.3e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Vmn1r177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vmn1r177 APN 7 23866328 missense possibly damaging 0.58
IGL01504:Vmn1r177 APN 7 23866410 missense probably damaging 0.98
IGL01535:Vmn1r177 APN 7 23866340 missense probably damaging 1.00
IGL01551:Vmn1r177 APN 7 23866263 missense probably benign 0.04
IGL01647:Vmn1r177 APN 7 23866175 missense probably damaging 1.00
ANU74:Vmn1r177 UTSW 7 23866220 missense possibly damaging 0.86
R0396:Vmn1r177 UTSW 7 23865597 missense probably damaging 1.00
R0894:Vmn1r177 UTSW 7 23866050 missense probably benign 0.09
R1446:Vmn1r177 UTSW 7 23866340 missense probably damaging 1.00
R1835:Vmn1r177 UTSW 7 23865686 missense probably damaging 1.00
R1893:Vmn1r177 UTSW 7 23866148 missense probably benign 0.02
R1995:Vmn1r177 UTSW 7 23865687 missense probably damaging 1.00
R2206:Vmn1r177 UTSW 7 23866131 missense probably damaging 1.00
R3889:Vmn1r177 UTSW 7 23865864 missense possibly damaging 0.86
R4458:Vmn1r177 UTSW 7 23866220 missense possibly damaging 0.86
R4579:Vmn1r177 UTSW 7 23866347 missense possibly damaging 0.46
R5290:Vmn1r177 UTSW 7 23866073 missense probably damaging 0.99
R6128:Vmn1r177 UTSW 7 23865842 missense probably damaging 0.99
R6128:Vmn1r177 UTSW 7 23865843 missense probably damaging 1.00
R6730:Vmn1r177 UTSW 7 23865812 missense probably damaging 1.00
R6785:Vmn1r177 UTSW 7 23866137 missense probably damaging 1.00
R7100:Vmn1r177 UTSW 7 23866110 missense probably benign 0.15
R8191:Vmn1r177 UTSW 7 23866311 nonsense probably null
X0020:Vmn1r177 UTSW 7 23866293 missense probably damaging 1.00
Z1177:Vmn1r177 UTSW 7 23865935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGCCGACACTGAAGCCAG -3'
(R):5'- GCTGAGACCCAAAGAAGTGATTTG -3'

Sequencing Primer
(F):5'- AACAGACCCACTTACTTTTAGTGCTG -3'
(R):5'- GTACTAACATGGCTGTGTCCAG -3'
Posted On2019-11-26