Incidental Mutation 'R7738:Cep57l1'
ID596378
Institutional Source Beutler Lab
Gene Symbol Cep57l1
Ensembl Gene ENSMUSG00000019813
Gene Namecentrosomal protein 57-like 1
Synonyms4930484D11Rik, 2410017P07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41718840-41809871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41740846 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 148 (E148D)
Ref Sequence ENSEMBL: ENSMUSP00000139509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000105505] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect probably damaging
Transcript: ENSMUST00000019951
AA Change: E148D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105505
AA Change: E148D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101144
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186239
AA Change: E148D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187143
AA Change: E148D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189770
AA Change: E148D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190022
AA Change: E72D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813
AA Change: E72D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191498
AA Change: E148D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813
AA Change: E148D

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Cep57l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep57l1 APN 10 41721551 intron probably benign
IGL00679:Cep57l1 APN 10 41719800 nonsense probably null
IGL00839:Cep57l1 APN 10 41731093 missense probably damaging 1.00
IGL01013:Cep57l1 APN 10 41740869 nonsense probably null
IGL01479:Cep57l1 APN 10 41728639 missense possibly damaging 0.95
IGL01830:Cep57l1 APN 10 41728653 missense probably benign 0.03
IGL02005:Cep57l1 APN 10 41740961 missense probably benign 0.39
IGL02679:Cep57l1 APN 10 41729386 missense probably damaging 1.00
IGL02697:Cep57l1 APN 10 41722954 missense possibly damaging 0.83
IGL03328:Cep57l1 APN 10 41743152 missense probably damaging 1.00
R2147:Cep57l1 UTSW 10 41740899 missense probably damaging 0.97
R3712:Cep57l1 UTSW 10 41743114 missense probably damaging 1.00
R4049:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4050:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4661:Cep57l1 UTSW 10 41719771 missense possibly damaging 0.91
R4764:Cep57l1 UTSW 10 41721682 missense possibly damaging 0.81
R4929:Cep57l1 UTSW 10 41745914 missense possibly damaging 0.93
R6058:Cep57l1 UTSW 10 41740922 missense possibly damaging 0.87
R6386:Cep57l1 UTSW 10 41743132 missense probably damaging 1.00
R6788:Cep57l1 UTSW 10 41743149 missense probably damaging 1.00
R7334:Cep57l1 UTSW 10 41721600 missense probably benign 0.00
R7724:Cep57l1 UTSW 10 41745842 missense possibly damaging 0.65
R7792:Cep57l1 UTSW 10 41722940 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATGTTGGCCTAAACAGCAG -3'
(R):5'- TTTGCACCACGTGTATAACAAC -3'

Sequencing Primer
(F):5'- AGCAGAGTCTACCATTGCTG -3'
(R):5'- CACACAAAGTCACTTTAGCATTGGG -3'
Posted On2019-11-26