Incidental Mutation 'R7738:Zfp729b'
ID596386
Institutional Source Beutler Lab
Gene Symbol Zfp729b
Ensembl Gene ENSMUSG00000058093
Gene Namezinc finger protein 729b
SynonymsAA987161
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67589439-67609707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67592075 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 690 (N690K)
Ref Sequence ENSEMBL: ENSMUSP00000012873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably benign
Transcript: ENSMUST00000012873
AA Change: N690K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: N690K

DomainStartEndE-ValueType
KRAB 5 65 1.63e-28 SMART
ZnF_C2H2 132 154 3.58e-2 SMART
PHD 133 194 1e1 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 188 210 6.78e-3 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
PHD 217 278 7.77e0 SMART
ZnF_C2H2 244 266 6.67e-2 SMART
ZnF_C2H2 272 294 1.12e-3 SMART
ZnF_C2H2 300 322 1.79e-2 SMART
PHD 301 362 1.65e1 SMART
ZnF_C2H2 328 350 2.57e-3 SMART
ZnF_C2H2 356 378 2.43e-4 SMART
ZnF_C2H2 412 434 1.67e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
PHD 441 502 4.46e0 SMART
ZnF_C2H2 468 490 1.58e-3 SMART
ZnF_C2H2 496 518 2.95e-3 SMART
ZnF_C2H2 524 546 4.47e-3 SMART
PHD 525 586 5.77e0 SMART
ZnF_C2H2 552 574 5.42e-2 SMART
ZnF_C2H2 580 602 1.03e-2 SMART
ZnF_C2H2 608 630 5.5e-3 SMART
PHD 609 670 1.52e1 SMART
ZnF_C2H2 636 658 6.99e-5 SMART
ZnF_C2H2 664 686 3.34e-2 SMART
ZnF_C2H2 720 742 3.63e-3 SMART
PHD 721 782 2.67e0 SMART
ZnF_C2H2 748 770 5.42e-2 SMART
ZnF_C2H2 776 798 5.14e-3 SMART
ZnF_C2H2 804 826 4.17e-3 SMART
ZnF_C2H2 832 854 1.47e-3 SMART
PHD 833 894 4.93e0 SMART
ZnF_C2H2 860 882 3.83e-2 SMART
ZnF_C2H2 888 910 4.4e-2 SMART
ZnF_C2H2 916 938 7.78e-3 SMART
ZnF_C2H2 944 966 4.17e-3 SMART
ZnF_C2H2 972 994 1.38e-3 SMART
ZnF_C2H2 1000 1022 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138725
SMART Domains Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093

DomainStartEndE-ValueType
KRAB 15 75 1.63e-28 SMART
ZnF_C2H2 142 164 3.58e-2 SMART
ZnF_C2H2 170 192 3.21e-4 SMART
ZnF_C2H2 198 220 6.78e-3 SMART
ZnF_C2H2 226 248 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Other mutations in Zfp729b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Zfp729b APN 13 67595230 missense probably benign 0.09
IGL02852:Zfp729b APN 13 67592823 missense probably damaging 0.99
PIT4449001:Zfp729b UTSW 13 67591423 missense probably benign 0.01
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0450:Zfp729b UTSW 13 67591134 missense probably benign
R0510:Zfp729b UTSW 13 67591134 missense probably benign
R1122:Zfp729b UTSW 13 67595284 missense possibly damaging 0.75
R1400:Zfp729b UTSW 13 67592794 missense possibly damaging 0.63
R1915:Zfp729b UTSW 13 67593220 missense probably damaging 1.00
R1929:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2229:Zfp729b UTSW 13 67595265 missense probably damaging 0.99
R2270:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2271:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2344:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2377:Zfp729b UTSW 13 67591701 missense possibly damaging 0.70
R2930:Zfp729b UTSW 13 67591854 missense probably benign
R3053:Zfp729b UTSW 13 67593466 missense probably damaging 1.00
R3404:Zfp729b UTSW 13 67591164 missense probably damaging 0.98
R4118:Zfp729b UTSW 13 67592710 missense possibly damaging 0.91
R4947:Zfp729b UTSW 13 67596672 missense probably damaging 1.00
R5408:Zfp729b UTSW 13 67591444 missense probably benign 0.18
R5511:Zfp729b UTSW 13 67592380 missense probably damaging 1.00
R5542:Zfp729b UTSW 13 67591021 missense probably benign
R5908:Zfp729b UTSW 13 67591255 missense probably benign 0.00
R5977:Zfp729b UTSW 13 67591621 missense probably benign 0.03
R5996:Zfp729b UTSW 13 67593858 missense probably benign 0.18
R7086:Zfp729b UTSW 13 67592937 missense probably damaging 0.99
R7146:Zfp729b UTSW 13 67593376 missense probably damaging 1.00
R7217:Zfp729b UTSW 13 67595248 missense probably damaging 0.96
R7332:Zfp729b UTSW 13 67609636 utr 5 prime probably null
R7472:Zfp729b UTSW 13 67593883 missense probably benign 0.00
R7615:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R7639:Zfp729b UTSW 13 67591852 missense probably benign 0.02
R7652:Zfp729b UTSW 13 67591252 missense probably benign 0.00
R8137:Zfp729b UTSW 13 67592742 missense probably damaging 1.00
X0023:Zfp729b UTSW 13 67592459 missense possibly damaging 0.95
X0028:Zfp729b UTSW 13 67592194 missense probably damaging 1.00
Z1088:Zfp729b UTSW 13 67593070 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TACATCACACTTGTACGGTTTCTC -3'
(R):5'- AAGTGTGACATATGTGACCAGGC -3'

Sequencing Primer
(F):5'- ACTTGTACGGTTTCTCTCTTGTATG -3'
(R):5'- AAGTGTGTGACAAGGCCTTCC -3'
Posted On2019-11-26