Incidental Mutation 'R7738:Nfatc4'
ID596387
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms3110041H08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55823144-55833943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55831957 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 647 (T647A)
Ref Sequence ENSEMBL: ENSMUSP00000024179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024179
AA Change: T647A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: T647A

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172271
AA Change: T647A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: T647A

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226357
AA Change: T577A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 55832562 missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 55832505 missense probably benign 0.03
IGL01791:Nfatc4 APN 14 55832238 missense probably null 0.04
IGL02536:Nfatc4 APN 14 55829910 missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 55831654 missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 55830028 missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0965:Nfatc4 UTSW 14 55826586 missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 55832631 missense probably damaging 1.00
R2309:Nfatc4 UTSW 14 55827004 missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 55832834 unclassified probably benign
R4200:Nfatc4 UTSW 14 55832032 missense probably damaging 1.00
R4905:Nfatc4 UTSW 14 55830582 missense probably benign 0.16
R5067:Nfatc4 UTSW 14 55832418 missense probably damaging 0.98
R5202:Nfatc4 UTSW 14 55826659 missense probably damaging 1.00
R5415:Nfatc4 UTSW 14 55832634 missense probably benign
R5585:Nfatc4 UTSW 14 55826755 missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 55832276 missense probably benign 0.02
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6172:Nfatc4 UTSW 14 55829533 missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 55825055 missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 55831964 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GAAGTGGCGTCCAGAGTAAC -3'
(R):5'- CCTCCTTGAAGACCACTAGGAAG -3'

Sequencing Primer
(F):5'- CCAGAGTAACTTTTTCTGTCCGGAAG -3'
(R):5'- TCCTTGAAGACCACTAGGAAGATGAG -3'
Posted On2019-11-26