Incidental Mutation 'R7738:Enox1'
ID596388
Institutional Source Beutler Lab
Gene Symbol Enox1
Ensembl Gene ENSMUSG00000022012
Gene Nameecto-NOX disulfide-thiol exchanger 1
SynonymsD230005D02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location77156763-77721760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77577780 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 126 (N126T)
Ref Sequence ENSEMBL: ENSMUSP00000022589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022589] [ENSMUST00000227662] [ENSMUST00000227831]
Predicted Effect probably damaging
Transcript: ENSMUST00000022589
AA Change: N126T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022589
Gene: ENSMUSG00000022012
AA Change: N126T

DomainStartEndE-ValueType
low complexity region 95 105 N/A INTRINSIC
RRM 143 209 2.41e-8 SMART
low complexity region 233 251 N/A INTRINSIC
coiled coil region 307 342 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
coiled coil region 425 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227662
AA Change: N126T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227831
AA Change: N126T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in plasma membrane electron transport pathways. The encoded protein has both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity. The two activities cycle with a periodicity of 24 minutes, with one activity being at its peak when the other is at its lowest. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Enox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Enox1 APN 14 77582404 missense possibly damaging 0.63
IGL01376:Enox1 APN 14 77251843 intron probably benign
IGL01509:Enox1 APN 14 77699273 missense probably damaging 1.00
IGL01684:Enox1 APN 14 77579093 missense possibly damaging 0.81
IGL01874:Enox1 APN 14 77579162 missense probably damaging 1.00
IGL03324:Enox1 APN 14 77615485 missense probably damaging 1.00
Soft UTSW 14 77486017 intron probably benign
R0037:Enox1 UTSW 14 77699310 splice site probably benign
R0112:Enox1 UTSW 14 77699198 missense possibly damaging 0.77
R0543:Enox1 UTSW 14 77506959 splice site probably benign
R0569:Enox1 UTSW 14 77637677 missense probably damaging 0.99
R0708:Enox1 UTSW 14 77592912 missense probably benign 0.28
R0811:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R0812:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R1417:Enox1 UTSW 14 77486005 intron probably benign
R1654:Enox1 UTSW 14 77611374 missense possibly damaging 0.87
R1678:Enox1 UTSW 14 77577656 missense probably benign 0.00
R1817:Enox1 UTSW 14 77615475 missense possibly damaging 0.84
R1976:Enox1 UTSW 14 77668793 missense probably benign
R2520:Enox1 UTSW 14 77582399 missense probably damaging 0.99
R3880:Enox1 UTSW 14 77611386 missense possibly damaging 0.49
R4096:Enox1 UTSW 14 77577720 missense probably damaging 0.99
R4885:Enox1 UTSW 14 77720850 missense probably damaging 1.00
R4998:Enox1 UTSW 14 77501435 intron probably benign
R5110:Enox1 UTSW 14 77707687 critical splice donor site probably null
R5341:Enox1 UTSW 14 77577656 missense possibly damaging 0.94
R5469:Enox1 UTSW 14 77592974 missense probably benign 0.00
R5596:Enox1 UTSW 14 77579053 missense probably benign 0.42
R5833:Enox1 UTSW 14 77506939 missense probably benign 0.01
R5892:Enox1 UTSW 14 77486017 intron probably benign
R6174:Enox1 UTSW 14 77508187 missense possibly damaging 0.93
R6267:Enox1 UTSW 14 77577764 missense probably damaging 1.00
R6867:Enox1 UTSW 14 77699299 critical splice donor site probably null
R7069:Enox1 UTSW 14 77611324 missense probably damaging 0.99
R7219:Enox1 UTSW 14 77720844 missense probably benign 0.15
R7316:Enox1 UTSW 14 77720858 missense probably benign 0.01
Z1177:Enox1 UTSW 14 77668747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCAACGTGTTGTCTTGTATGC -3'
(R):5'- ATAAACTCTCCGAGCTCACTG -3'

Sequencing Primer
(F):5'- GTTGTCTTGTATGCTTTCACAGAC -3'
(R):5'- GAGCTCACTGGCTTCATGGTAC -3'
Posted On2019-11-26