Incidental Mutation 'R7738:Has2'
ID596389
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56667712 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 536 (K536E)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050544
AA Change: K536E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: K536E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2656:Has2 UTSW 15 56681828 missense possibly damaging 0.90
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5698:Has2 UTSW 15 56667916 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6433:Has2 UTSW 15 56667798 missense possibly damaging 0.79
R6560:Has2 UTSW 15 56668264 missense probably damaging 1.00
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7597:Has2 UTSW 15 56668421 missense probably damaging 1.00
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCAGTGATATGTCTCCTGTGG -3'
(R):5'- GCACATCTGGAAGGAAGACC -3'

Sequencing Primer
(F):5'- ATATGTCTCCTGTGGTGGCAG -3'
(R):5'- CACATCTGGAAGGAAGACCATTGTTG -3'
Posted On2019-11-26