Incidental Mutation 'R7738:Tmem44'
ID596391
Institutional Source Beutler Lab
Gene Symbol Tmem44
Ensembl Gene ENSMUSG00000022537
Gene Nametransmembrane protein 44
Synonyms9330161C17Rik, 1700007N03Rik
Accession Numbers

Genbank: NM_172614.3; Ensembl: ENSMUST00000140402

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location30511855-30550842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30543410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 201 (S201T)
Ref Sequence ENSEMBL: ENSMUSP00000123494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089775] [ENSMUST00000140402] [ENSMUST00000144001] [ENSMUST00000149110]
Predicted Effect probably benign
Transcript: ENSMUST00000089775
SMART Domains Protein: ENSMUSP00000087207
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140402
AA Change: S201T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123494
Gene: ENSMUSG00000022537
AA Change: S201T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 179 197 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144001
SMART Domains Protein: ENSMUSP00000119318
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149110
SMART Domains Protein: ENSMUSP00000116531
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 44 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(8) : Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr198 G A 16: 59,201,955 A157V probably benign Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Tmem44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Tmem44 APN 16 30539381 splice site probably benign
IGL03308:Tmem44 APN 16 30543748 missense probably damaging 0.97
1mM(1):Tmem44 UTSW 16 30543497 unclassified probably benign
R0452:Tmem44 UTSW 16 30517463 splice site probably benign
R1073:Tmem44 UTSW 16 30514833 splice site probably benign
R1962:Tmem44 UTSW 16 30543401 critical splice donor site probably null
R2118:Tmem44 UTSW 16 30547444 nonsense probably null
R2122:Tmem44 UTSW 16 30547444 nonsense probably null
R2124:Tmem44 UTSW 16 30547444 nonsense probably null
R4870:Tmem44 UTSW 16 30540773 missense probably damaging 1.00
R5328:Tmem44 UTSW 16 30540891 missense possibly damaging 0.83
R6653:Tmem44 UTSW 16 30537551 missense probably damaging 0.97
R6818:Tmem44 UTSW 16 30543221 intron probably null
R7058:Tmem44 UTSW 16 30547395 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTACTGTTTAGCCATGGACCTTC -3'
(R):5'- AGAGGGTGAGGATTCTTGCC -3'

Sequencing Primer
(F):5'- CTGTTTAGCCATGGACCTTCATAAAC -3'
(R):5'- GGATTCTTGCCATTGAAAAGAGGTTC -3'
Posted On2019-11-26