Incidental Mutation 'R7738:Olfr198'
ID596392
Institutional Source Beutler Lab
Gene Symbol Olfr198
Ensembl Gene ENSMUSG00000052537
Gene Nameolfactory receptor 198
SynonymsGA_x54KRFPKG5P-55416332-55415412, MOR182-8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7738 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59200352-59203533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59201955 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 157 (A157V)
Ref Sequence ENSEMBL: ENSMUSP00000146813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064452] [ENSMUST00000208244]
Predicted Effect probably benign
Transcript: ENSMUST00000064452
AA Change: A157V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065535
Gene: ENSMUSG00000052537
AA Change: A157V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.9e-45 PFAM
Pfam:7tm_1 41 290 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208244
AA Change: A157V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T A 1: 6,389,504 D101E probably benign Het
Ank2 C T 3: 126,947,622 A1538T Het
Arhgap21 A G 2: 20,849,479 S1701P probably damaging Het
Arhgap21 A G 2: 20,850,358 Y1408H probably damaging Het
Armc3 A T 2: 19,288,950 L517F probably damaging Het
Cep57l1 T A 10: 41,740,846 E148D probably damaging Het
Clstn1 A C 4: 149,635,354 Q452P probably damaging Het
Csmd1 C A 8: 16,100,990 R1437L probably damaging Het
Dcbld1 C T 10: 52,312,826 T249I possibly damaging Het
Dsp A G 13: 38,185,175 E749G probably damaging Het
Enox1 A C 14: 77,577,780 N126T probably damaging Het
Fgfr1 T A 8: 25,558,185 L99Q probably damaging Het
Fscn3 G A 6: 28,434,446 R340Q probably benign Het
Glrb C T 3: 80,860,184 C243Y probably damaging Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Has2 T C 15: 56,667,712 K536E possibly damaging Het
Igtp A G 11: 58,207,080 E359G probably benign Het
Kat14 A G 2: 144,394,242 D509G probably damaging Het
Kbtbd2 C A 6: 56,779,737 S338I possibly damaging Het
Mpdz A G 4: 81,335,749 S1049P probably benign Het
Ncoa3 C T 2: 166,050,067 A121V probably damaging Het
Nfatc4 A G 14: 55,831,957 T647A possibly damaging Het
Nip7 T C 8: 107,057,365 F79S probably damaging Het
Nrxn3 A C 12: 88,850,304 E251D possibly damaging Het
Olfr544 C A 7: 102,484,611 V170F probably damaging Het
Olig2 T C 16: 91,227,160 I254T unknown Het
Ostf1 A T 19: 18,584,701 L177* probably null Het
Pabpc2 A T 18: 39,774,266 I195F possibly damaging Het
Pacs1 A T 19: 5,152,350 M404K probably benign Het
Pcdh1 A G 18: 38,197,476 S964P probably benign Het
Pcdhb3 T A 18: 37,302,959 N659K probably benign Het
Pla2g6 A T 15: 79,297,433 Y537* probably null Het
Plekhn1 G A 4: 156,232,234 T330M probably damaging Het
Proc G A 18: 32,127,479 R198* probably null Het
Rfx8 G T 1: 39,682,931 T298K probably damaging Het
S1pr4 A C 10: 81,498,507 S378A probably benign Het
Slfn2 T A 11: 83,069,973 F259L probably damaging Het
Snx14 T C 9: 88,407,474 T242A probably benign Het
Sptbn2 A G 19: 4,724,125 N68S probably damaging Het
Tex45 T C 8: 3,483,525 F277S probably damaging Het
Tmem44 A T 16: 30,543,410 S201T probably benign Het
Ttc3 A T 16: 94,387,382 I177L probably benign Het
Vmn1r177 T C 7: 23,866,134 T106A probably damaging Het
Vmn1r28 T C 6: 58,266,054 M294T probably benign Het
Zfp518b G A 5: 38,672,187 T825I probably benign Het
Zfp729b A T 13: 67,592,075 N690K probably benign Het
Other mutations in Olfr198
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Olfr198 APN 16 59202097 missense possibly damaging 0.94
IGL03053:Olfr198 APN 16 59202247 missense probably damaging 1.00
IGL03168:Olfr198 APN 16 59202247 missense probably damaging 1.00
R1355:Olfr198 UTSW 16 59201680 missense probably damaging 1.00
R1370:Olfr198 UTSW 16 59201680 missense probably damaging 1.00
R1510:Olfr198 UTSW 16 59202183 missense probably damaging 0.99
R1777:Olfr198 UTSW 16 59202016 missense probably benign 0.35
R1962:Olfr198 UTSW 16 59201908 missense possibly damaging 0.88
R1964:Olfr198 UTSW 16 59201908 missense possibly damaging 0.88
R5409:Olfr198 UTSW 16 59201557 missense probably damaging 1.00
R5642:Olfr198 UTSW 16 59202006 missense probably damaging 1.00
R5704:Olfr198 UTSW 16 59202006 missense probably damaging 1.00
R6323:Olfr198 UTSW 16 59202282 missense probably damaging 1.00
R6829:Olfr198 UTSW 16 59201535 missense probably damaging 1.00
R7315:Olfr198 UTSW 16 59202133 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGGATGGCAAGAAGGAC -3'
(R):5'- TTGGTTGAGTGCTTCACCC -3'

Sequencing Primer
(F):5'- CAGAGAAGTAGGAGACGATAATAGTC -3'
(R):5'- GAGTGCTTCACCCAGTTTTATTTC -3'
Posted On2019-11-26