Mutagenetix > Incidental Mutations

Incidental Mutation 'R7738:Pacs1'

596400

Institutional Source

Beutler Lab

Gene Symbol

Pacs1

Ensembl Gene

ENSMUSG00000024855

Gene Name

phosphofurin acidic cluster sorting protein 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7738 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5133688-5273119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5152350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 404 (M404K)

Ref Sequence

ENSEMBL: ENSMUSP00000025786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025786]

AlphaFold

Q8K212

Predicted Effect

probably benign
Transcript: ENSMUST00000025786
AA Change: M404K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: M404K

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
low complexity region	27	46	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	306	320	N/A	INTRINSIC
low complexity region	359	372	N/A	INTRINSIC
Pfam:Pacs-1	546	958	2e-193	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkal1	T	A	1: 6,389,504	D101E	probably benign	Het
Ank2	C	T	3: 126,947,622	A1538T		Het
Arhgap21	A	G	2: 20,849,479	S1701P	probably damaging	Het
Arhgap21	A	G	2: 20,850,358	Y1408H	probably damaging	Het
Armc3	A	T	2: 19,288,950	L517F	probably damaging	Het
Cep57l1	T	A	10: 41,740,846	E148D	probably damaging	Het
Clstn1	A	C	4: 149,635,354	Q452P	probably damaging	Het
Csmd1	C	A	8: 16,100,990	R1437L	probably damaging	Het
Dcbld1	C	T	10: 52,312,826	T249I	possibly damaging	Het
Dsp	A	G	13: 38,185,175	E749G	probably damaging	Het
Enox1	A	C	14: 77,577,780	N126T	probably damaging	Het
Fgfr1	T	A	8: 25,558,185	L99Q	probably damaging	Het
Fscn3	G	A	6: 28,434,446	R340Q	probably benign	Het
Glrb	C	T	3: 80,860,184	C243Y	probably damaging	Het
Gpld1	A	T	13: 24,962,322	Y183F	probably damaging	Het
Has2	T	C	15: 56,667,712	K536E	possibly damaging	Het
Igtp	A	G	11: 58,207,080	E359G	probably benign	Het
Kat14	A	G	2: 144,394,242	D509G	probably damaging	Het
Kbtbd2	C	A	6: 56,779,737	S338I	possibly damaging	Het
Mpdz	A	G	4: 81,335,749	S1049P	probably benign	Het
Ncoa3	C	T	2: 166,050,067	A121V	probably damaging	Het
Nfatc4	A	G	14: 55,831,957	T647A	possibly damaging	Het
Nip7	T	C	8: 107,057,365	F79S	probably damaging	Het
Nrxn3	A	C	12: 88,850,304	E251D	possibly damaging	Het
Olfr198	G	A	16: 59,201,955	A157V	probably benign	Het
Olfr544	C	A	7: 102,484,611	V170F	probably damaging	Het
Olig2	T	C	16: 91,227,160	I254T	unknown	Het
Ostf1	A	T	19: 18,584,701	L177*	probably null	Het
Pabpc2	A	T	18: 39,774,266	I195F	possibly damaging	Het
Pcdh1	A	G	18: 38,197,476	S964P	probably benign	Het
Pcdhb3	T	A	18: 37,302,959	N659K	probably benign	Het
Pla2g6	A	T	15: 79,297,433	Y537*	probably null	Het
Plekhn1	G	A	4: 156,232,234	T330M	probably damaging	Het
Proc	G	A	18: 32,127,479	R198*	probably null	Het
Rfx8	G	T	1: 39,682,931	T298K	probably damaging	Het
S1pr4	A	C	10: 81,498,507	S378A	probably benign	Het
Slfn2	T	A	11: 83,069,973	F259L	probably damaging	Het
Snx14	T	C	9: 88,407,474	T242A	probably benign	Het
Sptbn2	A	G	19: 4,724,125	N68S	probably damaging	Het
Tex45	T	C	8: 3,483,525	F277S	probably damaging	Het
Tmem44	A	T	16: 30,543,410	S201T	probably benign	Het
Ttc3	A	T	16: 94,387,382	I177L	probably benign	Het
Vmn1r177	T	C	7: 23,866,134	T106A	probably damaging	Het
Vmn1r28	T	C	6: 58,266,054	M294T	probably benign	Het
Zfp518b	G	A	5: 38,672,187	T825I	probably benign	Het
Zfp729b	A	T	13: 67,592,075	N690K	probably benign	Het

Other mutations in Pacs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Pacs1	APN	19	5153698	missense	probably damaging	0.98
IGL01335:Pacs1	APN	19	5142632	missense	probably damaging	1.00
IGL01717:Pacs1	APN	19	5167972	missense	probably damaging	1.00
IGL02453:Pacs1	APN	19	5135005	missense	probably damaging	1.00
IGL02887:Pacs1	APN	19	5135110	splice site	probably benign
Batavian	UTSW	19	5156413	missense	possibly damaging	0.71
chicory	UTSW	19	5139297	missense	probably benign	0.33
endive	UTSW	19	5272583	nonsense	probably null
Escarole	UTSW	19	5156356	critical splice donor site	probably null
frisee	UTSW	19	5136791	missense	probably damaging	1.00
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0316:Pacs1	UTSW	19	5135121	splice site	silent
R0369:Pacs1	UTSW	19	5141698	missense	probably damaging	1.00
R0443:Pacs1	UTSW	19	5272583	nonsense	probably null
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0974:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R1202:Pacs1	UTSW	19	5135237	missense	probably damaging	1.00
R1672:Pacs1	UTSW	19	5152309	missense	probably benign	0.00
R1689:Pacs1	UTSW	19	5272615	unclassified	probably benign
R1842:Pacs1	UTSW	19	5155884	missense	probably damaging	0.96
R1847:Pacs1	UTSW	19	5153714	missense	probably damaging	0.99
R3884:Pacs1	UTSW	19	5155759	missense	probably damaging	0.99
R4577:Pacs1	UTSW	19	5143833	nonsense	probably null
R4630:Pacs1	UTSW	19	5156356	critical splice donor site	probably null
R5029:Pacs1	UTSW	19	5142271	missense	probably benign	0.03
R5198:Pacs1	UTSW	19	5139297	missense	probably benign	0.33
R5223:Pacs1	UTSW	19	5145141	missense	probably benign	0.00
R5464:Pacs1	UTSW	19	5147207	missense	probably benign
R5695:Pacs1	UTSW	19	5136791	missense	probably damaging	1.00
R6128:Pacs1	UTSW	19	5152372	splice site	probably null
R6335:Pacs1	UTSW	19	5159977	missense	probably damaging	1.00
R6802:Pacs1	UTSW	19	5152784	missense	probably damaging	0.99
R6831:Pacs1	UTSW	19	5160795	missense	probably damaging	1.00
R7071:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R7200:Pacs1	UTSW	19	5156413	missense	possibly damaging	0.71
R7248:Pacs1	UTSW	19	5138975	missense	probably damaging	1.00
R7576:Pacs1	UTSW	19	5145120	missense	probably benign	0.09
R7682:Pacs1	UTSW	19	5152699	missense	probably damaging	0.99
R7715:Pacs1	UTSW	19	5141681	missense	probably benign	0.01
R8339:Pacs1	UTSW	19	5142623	missense	probably damaging	1.00
R8930:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R8932:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R9043:Pacs1	UTSW	19	5138936	missense	probably benign	0.23
R9211:Pacs1	UTSW	19	5139029	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGAAGATACTTTGTAGGCCCC -3'
(R):5'- CATCTCCATGGCAAGAGTCC -3'

Sequencing Primer
(F):5'- GATACTTTGTAGGCCCCCAAAGG -3'
(R):5'- TCTCCATGGCAAGAGTCCTGATAG -3'

Posted On

2019-11-26