Mutagenetix > Incidental Mutations

Incidental Mutation 'R7739:Gm8251'

596403

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R7739 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44056418 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1840 (T1840I)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168641
AA Change: T1840I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: T1840I

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016C15Rik	T	A	1: 177,743,262	I54K	probably damaging	Het
9130401M01Rik	C	A	15: 58,022,479	A336S	probably benign	Het
Abca8b	A	G	11: 109,974,591	S347P	probably benign	Het
Acvr1	T	C	2: 58,462,971	T326A	possibly damaging	Het
Atp13a4	A	G	16: 29,456,601	I355T		Het
Atp2a2	G	A	5: 122,469,705	T247I	probably damaging	Het
Atp2b1	T	A	10: 99,001,365	D555E	probably benign	Het
Aurkb	G	T	11: 69,048,232	G94*	probably null	Het
B130006D01Rik	A	T	11: 95,726,160	H37L	unknown	Het
Cabin1	A	G	10: 75,658,658	L1629P	probably damaging	Het
Ccdc80	A	C	16: 45,095,823	D314A	probably benign	Het
Cdc42bpg	T	A	19: 6,310,815	I201N	probably damaging	Het
Chd9	T	C	8: 91,035,025	L2246P	probably damaging	Het
Cpsf1	T	A	15: 76,600,311	M657L	probably benign	Het
Dmtf1	A	G	5: 9,140,453	V87A	probably damaging	Het
Drd5	G	T	5: 38,320,078	W138L	probably damaging	Het
Dspp	G	A	5: 104,178,146	D792N	unknown	Het
Fat2	C	A	11: 55,281,131	E2919*	probably null	Het
Fgf20	A	G	8: 40,279,896	V167A	probably damaging	Het
Gm597	T	A	1: 28,777,608	T448S	possibly damaging	Het
Grm5	T	C	7: 88,130,058	V934A	possibly damaging	Het
Gtf3c3	G	T	1: 54,405,039	A730D	possibly damaging	Het
H2-T24	A	G	17: 36,014,591	V335A	probably benign	Het
Havcr2	T	G	11: 46,456,557	N120K	probably damaging	Het
Hmcn2	T	C	2: 31,458,026	F4895L	possibly damaging	Het
Igsf3	T	C	3: 101,435,531	Y475H	probably damaging	Het
Lonp1	T	C	17: 56,626,620	D85G	probably benign	Het
Lrrc49	T	C	9: 60,593,692	S657G	probably benign	Het
Lrrk2	T	A	15: 91,700,613	Y382N	probably damaging	Het
Macf1	T	C	4: 123,385,598	D3870G	probably damaging	Het
Mtf1	T	A	4: 124,824,288	C260S	probably damaging	Het
Naa35	A	G	13: 59,599,784	D110G	probably damaging	Het
Npas3	A	T	12: 54,068,718	T808S	probably damaging	Het
Olfr76	A	G	19: 12,120,545	W56R	probably damaging	Het
Pax9	A	T	12: 56,700,099	H240L	probably benign	Het
Pik3c2a	T	C	7: 116,394,294	T413A	probably benign	Het
Pik3r1	A	G	13: 101,709,697	V127A	probably benign	Het
Pik3r5	A	G	11: 68,490,498	E170G	probably damaging	Het
Polr1a	T	C	6: 71,954,835	I966T	possibly damaging	Het
Prelid2	A	G	18: 41,912,368		probably null	Het
Rab29	T	A	1: 131,872,185	M166K	probably damaging	Het
Rab2b	T	C	14: 52,266,260	E135G	probably damaging	Het
Rnf103	T	A	6: 71,509,479	S365T	possibly damaging	Het
Rnf213	G	A	11: 119,410,861	E387K		Het
Sh3d19	T	C	3: 86,123,731	V734A	probably benign	Het
Ssbp1	T	G	6: 40,477,980	N124K	probably damaging	Het
Tbc1d31	C	T	15: 57,936,098	R227*	probably null	Het
Tcerg1	A	G	18: 42,523,974	T174A	unknown	Het
Tenm2	T	C	11: 36,069,561	S980G	possibly damaging	Het
Trim30a	T	C	7: 104,430,179	I156M	possibly damaging	Het
Trim39	T	C	17: 36,260,504	D454G	possibly damaging	Het
Trpc7	A	T	13: 56,773,766	*863K	probably null	Het
Tubgcp3	A	G	8: 12,657,561	Y143H	probably benign	Het
Vmn1r33	C	T	6: 66,612,373	D66N	probably benign	Het
Vmn2r8	A	T	5: 108,802,177	I268N	probably damaging	Het
Vmn2r91	A	C	17: 18,135,818	E582D	probably benign	Het
Vtcn1	T	C	3: 100,883,895	F83S	probably damaging	Het
Wdr81	G	T	11: 75,441,985	D684E		Het
Wipi1	A	G	11: 109,579,709	S295P	probably damaging	Het
Zfp27	A	T	7: 29,894,274	H755Q	possibly damaging	Het
Zfp963	A	G	8: 69,742,883	F307L	possibly damaging	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5559:Gm8251	UTSW	1	44058515	missense	possibly damaging	0.77
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGCCAATGAGCATTTGGC -3'
(R):5'- TGTGGCACAACCTTTCTATCAGTC -3'

Sequencing Primer
(F):5'- GCATTTGGCTCTGGCATCTG -3'
(R):5'- TCTCAAAATAGCAGGAAATGTAGGTC -3'

Posted On

2019-11-26