Incidental Mutation 'R7739:Rnf103'
ID596421
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Namering finger protein 103
SynonymsZfp103, kf-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71493894-71510881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71509479 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 365 (S365T)
Ref Sequence ENSEMBL: ENSMUSP00000066324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064637
AA Change: S365T

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: S365T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114179
AA Change: S365T

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: S365T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp13a4 A G 16: 29,456,601 I355T Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Fgf20 A G 8: 40,279,896 V167A probably damaging Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lonp1 T C 17: 56,626,620 D85G probably benign Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Polr1a T C 6: 71,954,835 I966T possibly damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trim39 T C 17: 36,260,504 D454G possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71509749 missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71509083 missense probably benign 0.00
IGL01601:Rnf103 APN 6 71509183 missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71510382 missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71509564 missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71510188 missense probably benign 0.01
IGL02386:Rnf103 APN 6 71509218 missense probably benign
IGL02532:Rnf103 APN 6 71509825 missense probably benign 0.19
IGL02532:Rnf103 APN 6 71509652 missense probably damaging 0.96
IGL02747:Rnf103 APN 6 71509177 missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71509705 missense probably benign 0.41
IGL03247:Rnf103 APN 6 71510305 missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71509331 missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71509702 missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71509582 missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71508999 missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71510017 missense probably benign 0.08
R3847:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71510347 missense probably benign 0.08
R4914:Rnf103 UTSW 6 71510264 missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71510008 missense probably benign 0.04
R5634:Rnf103 UTSW 6 71509617 missense probably benign 0.01
R5682:Rnf103 UTSW 6 71508724 intron probably benign
R5791:Rnf103 UTSW 6 71508925 missense probably damaging 0.99
R5994:Rnf103 UTSW 6 71496910 missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71505824 missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71510365 missense probably damaging 1.00
R7819:Rnf103 UTSW 6 71508930 missense probably benign 0.00
R7903:Rnf103 UTSW 6 71509154 missense probably damaging 1.00
R8750:Rnf103 UTSW 6 71509618 missense probably benign 0.11
R8784:Rnf103 UTSW 6 71509998 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TATATCCCTTCAGGCCATGGATTC -3'
(R):5'- GCGACGTCTCTTCTTCTCAAAG -3'

Sequencing Primer
(F):5'- CAGGCCATGGATTCATTTCTGCG -3'
(R):5'- CCATGTCCAAGGTATGTACTGAG -3'
Posted On2019-11-26