Mutagenetix > Incidental Mutations

Incidental Mutation 'R7739:Polr1a'

596422

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7739 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71954835 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 966 (I966T)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055296
AA Change: I966T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I966T

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206513

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016C15Rik	T	A	1: 177,743,262	I54K	probably damaging	Het
9130401M01Rik	C	A	15: 58,022,479	A336S	probably benign	Het
Abca8b	A	G	11: 109,974,591	S347P	probably benign	Het
Acvr1	T	C	2: 58,462,971	T326A	possibly damaging	Het
Atp13a4	A	G	16: 29,456,601	I355T		Het
Atp2a2	G	A	5: 122,469,705	T247I	probably damaging	Het
Atp2b1	T	A	10: 99,001,365	D555E	probably benign	Het
Aurkb	G	T	11: 69,048,232	G94*	probably null	Het
B130006D01Rik	A	T	11: 95,726,160	H37L	unknown	Het
Cabin1	A	G	10: 75,658,658	L1629P	probably damaging	Het
Ccdc80	A	C	16: 45,095,823	D314A	probably benign	Het
Cdc42bpg	T	A	19: 6,310,815	I201N	probably damaging	Het
Chd9	T	C	8: 91,035,025	L2246P	probably damaging	Het
Cpsf1	T	A	15: 76,600,311	M657L	probably benign	Het
Dmtf1	A	G	5: 9,140,453	V87A	probably damaging	Het
Drd5	G	T	5: 38,320,078	W138L	probably damaging	Het
Dspp	G	A	5: 104,178,146	D792N	unknown	Het
Fat2	C	A	11: 55,281,131	E2919*	probably null	Het
Fgf20	A	G	8: 40,279,896	V167A	probably damaging	Het
Gm597	T	A	1: 28,777,608	T448S	possibly damaging	Het
Gm8251	G	A	1: 44,056,418	T1840I	possibly damaging	Het
Grm5	T	C	7: 88,130,058	V934A	possibly damaging	Het
Gtf3c3	G	T	1: 54,405,039	A730D	possibly damaging	Het
H2-T24	A	G	17: 36,014,591	V335A	probably benign	Het
Havcr2	T	G	11: 46,456,557	N120K	probably damaging	Het
Hmcn2	T	C	2: 31,458,026	F4895L	possibly damaging	Het
Igsf3	T	C	3: 101,435,531	Y475H	probably damaging	Het
Lonp1	T	C	17: 56,626,620	D85G	probably benign	Het
Lrrc49	T	C	9: 60,593,692	S657G	probably benign	Het
Lrrk2	T	A	15: 91,700,613	Y382N	probably damaging	Het
Macf1	T	C	4: 123,385,598	D3870G	probably damaging	Het
Mtf1	T	A	4: 124,824,288	C260S	probably damaging	Het
Naa35	A	G	13: 59,599,784	D110G	probably damaging	Het
Npas3	A	T	12: 54,068,718	T808S	probably damaging	Het
Olfr76	A	G	19: 12,120,545	W56R	probably damaging	Het
Pax9	A	T	12: 56,700,099	H240L	probably benign	Het
Pik3c2a	T	C	7: 116,394,294	T413A	probably benign	Het
Pik3r1	A	G	13: 101,709,697	V127A	probably benign	Het
Pik3r5	A	G	11: 68,490,498	E170G	probably damaging	Het
Prelid2	A	G	18: 41,912,368		probably null	Het
Rab29	T	A	1: 131,872,185	M166K	probably damaging	Het
Rab2b	T	C	14: 52,266,260	E135G	probably damaging	Het
Rnf103	T	A	6: 71,509,479	S365T	possibly damaging	Het
Rnf213	G	A	11: 119,410,861	E387K		Het
Sh3d19	T	C	3: 86,123,731	V734A	probably benign	Het
Ssbp1	T	G	6: 40,477,980	N124K	probably damaging	Het
Tbc1d31	C	T	15: 57,936,098	R227*	probably null	Het
Tcerg1	A	G	18: 42,523,974	T174A	unknown	Het
Tenm2	T	C	11: 36,069,561	S980G	possibly damaging	Het
Trim30a	T	C	7: 104,430,179	I156M	possibly damaging	Het
Trim39	T	C	17: 36,260,504	D454G	possibly damaging	Het
Trpc7	A	T	13: 56,773,766	*863K	probably null	Het
Tubgcp3	A	G	8: 12,657,561	Y143H	probably benign	Het
Vmn1r33	C	T	6: 66,612,373	D66N	probably benign	Het
Vmn2r8	A	T	5: 108,802,177	I268N	probably damaging	Het
Vmn2r91	A	C	17: 18,135,818	E582D	probably benign	Het
Vtcn1	T	C	3: 100,883,895	F83S	probably damaging	Het
Wdr81	G	T	11: 75,441,985	D684E		Het
Wipi1	A	G	11: 109,579,709	S295P	probably damaging	Het
Zfp27	A	T	7: 29,894,274	H755Q	possibly damaging	Het
Zfp963	A	G	8: 69,742,883	F307L	possibly damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTCCAAATGCTTTCCCTGAGG -3'
(R):5'- TTTGCTGGCCCTAGTATCAC -3'

Sequencing Primer
(F):5'- CCTGCTTGGACAGAGTGTC -3'
(R):5'- AGTATCACAGTGGGCATCTCCATG -3'

Posted On

2019-11-26