Incidental Mutation 'R7739:Polr1a'
ID596422
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71954835 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 966 (I966T)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055296
AA Change: I966T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I966T

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206513
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp13a4 A G 16: 29,456,601 I355T Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Fgf20 A G 8: 40,279,896 V167A probably damaging Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lonp1 T C 17: 56,626,620 D85G probably benign Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf103 T A 6: 71,509,479 S365T possibly damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trim39 T C 17: 36,260,504 D454G possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCAAATGCTTTCCCTGAGG -3'
(R):5'- TTTGCTGGCCCTAGTATCAC -3'

Sequencing Primer
(F):5'- CCTGCTTGGACAGAGTGTC -3'
(R):5'- AGTATCACAGTGGGCATCTCCATG -3'
Posted On2019-11-26