Incidental Mutation 'R7739:Fgf20'
ID596428
Institutional Source Beutler Lab
Gene Symbol Fgf20
Ensembl Gene ENSMUSG00000031603
Gene Namefibroblast growth factor 20
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40279166-40308331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40279896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000034014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034014] [ENSMUST00000118639]
Predicted Effect probably damaging
Transcript: ENSMUST00000034014
AA Change: V167A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034014
Gene: ENSMUSG00000031603
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
FGF 63 194 3.3e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118639
AA Change: V113A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112756
Gene: ENSMUSG00000031603
AA Change: V113A

DomainStartEndE-ValueType
FGF 6 140 2.08e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor family. The fibroblast growth factors possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene product is a secreted neurotrophic factor but lacks a typical signal peptide. It is expressed in normal brain, particularly the cerebellum, and may regulate central nervous system development and function. Homodimerization of this protein was shown to regulate its receptor binding activity and concentration gradient in the extracellular matrix. Genetic variations of this gene have been associated with Parkinson disease susceptibility. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired coclear lateral compartment differentiation and deafness without loss of vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp13a4 A G 16: 29,456,601 I355T Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lonp1 T C 17: 56,626,620 D85G probably benign Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Polr1a T C 6: 71,954,835 I966T possibly damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf103 T A 6: 71,509,479 S365T possibly damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trim39 T C 17: 36,260,504 D454G possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Fgf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Fgf20 APN 8 40279787 missense probably damaging 0.99
IGL03365:Fgf20 APN 8 40279891 missense possibly damaging 0.95
mermaid UTSW 8 40281148 missense probably damaging 0.98
LCD18:Fgf20 UTSW 8 40292318 intron probably benign
R1893:Fgf20 UTSW 8 40279803 missense possibly damaging 0.49
R4067:Fgf20 UTSW 8 40279855 missense probably benign 0.00
R4613:Fgf20 UTSW 8 40286611 missense probably benign
R6166:Fgf20 UTSW 8 40279840 missense probably damaging 0.98
R6280:Fgf20 UTSW 8 40281112 nonsense probably null
R6869:Fgf20 UTSW 8 40281148 missense probably damaging 0.98
R7561:Fgf20 UTSW 8 40279934 missense possibly damaging 0.92
R8191:Fgf20 UTSW 8 40308320 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGTAATATCCTGAACGTCTTCTTCG -3'
(R):5'- AGAGTTGAGGCTTTTGTAAGGAAC -3'

Sequencing Primer
(F):5'- ACGTCTTCTTCGGTGTTATTTAACAG -3'
(R):5'- GAATGCATCTTCAGGGAAC -3'
Posted On2019-11-26