Incidental Mutation 'R0067:Ticrr'
ID 59644
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 038358-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0067 (G1)
Quality Score 185
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79327158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 622 (D622V)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: D622V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: D622V

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: D622V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: D622V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,610,995 (GRCm39) V248M possibly damaging Het
Adamts9 T A 6: 92,867,148 (GRCm39) K79N probably damaging Het
AW209491 A T 13: 14,812,328 (GRCm39) I394F probably benign Het
Cacna1d A T 14: 29,796,967 (GRCm39) probably benign Het
Cacna1i A T 15: 80,265,373 (GRCm39) I1542F probably damaging Het
Cep97 A T 16: 55,735,924 (GRCm39) N291K possibly damaging Het
Clasp2 A T 9: 113,689,209 (GRCm39) probably benign Het
Coq8b T C 7: 26,932,906 (GRCm39) L5P possibly damaging Het
Dennd1c T C 17: 57,382,465 (GRCm39) Q67R probably damaging Het
Dysf T C 6: 84,040,313 (GRCm39) V119A possibly damaging Het
Eml1 A G 12: 108,429,786 (GRCm39) D23G possibly damaging Het
Eva1c A T 16: 90,663,305 (GRCm39) D13V possibly damaging Het
Fam151b T C 13: 92,610,504 (GRCm39) K95R probably benign Het
Glo1 A T 17: 30,813,245 (GRCm39) probably null Het
Gm11360 T A 13: 28,140,214 (GRCm39) M26K probably benign Het
Gps2 C T 11: 69,805,607 (GRCm39) Q42* probably null Het
Gypa A G 8: 81,229,710 (GRCm39) H102R possibly damaging Het
Hdac4 G A 1: 91,957,706 (GRCm39) H103Y probably damaging Het
Hivep1 T A 13: 42,312,132 (GRCm39) D1457E probably benign Het
Hunk A G 16: 90,244,200 (GRCm39) D110G probably damaging Het
L3mbtl1 A G 2: 162,790,748 (GRCm39) K225E probably damaging Het
Limch1 A G 5: 67,131,965 (GRCm39) S143G probably damaging Het
Macf1 T C 4: 123,369,041 (GRCm39) K342E possibly damaging Het
Mc5r T A 18: 68,472,637 (GRCm39) M332K probably damaging Het
Memo1 A G 17: 74,532,453 (GRCm39) V185A probably damaging Het
Mtrex C T 13: 113,023,396 (GRCm39) V727I probably benign Het
Myf6 A T 10: 107,329,340 (GRCm39) probably null Het
Myh14 G A 7: 44,272,551 (GRCm39) T1418I probably benign Het
Pbk G A 14: 66,052,675 (GRCm39) V173I possibly damaging Het
Plekha5 C T 6: 140,470,629 (GRCm39) T90I probably damaging Het
Ptbp2 T C 3: 119,514,290 (GRCm39) T478A probably benign Het
Rasgrp1 C A 2: 117,125,301 (GRCm39) R246S probably damaging Het
Rflnb A T 11: 75,912,987 (GRCm39) S134T possibly damaging Het
Rnf214 A G 9: 45,778,796 (GRCm39) probably null Het
Rps6ka5 T A 12: 100,582,342 (GRCm39) I177F probably damaging Het
Rtn2 T A 7: 19,028,396 (GRCm39) probably benign Het
Satb1 T C 17: 52,111,364 (GRCm39) T165A probably damaging Het
Scamp1 T C 13: 94,340,658 (GRCm39) Y237C probably damaging Het
Skint10 A T 4: 112,568,753 (GRCm39) F321L probably benign Het
Slc36a2 A G 11: 55,053,466 (GRCm39) probably benign Het
Slc8a1 A G 17: 81,745,188 (GRCm39) V672A probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Sp140l2 T A 1: 85,247,773 (GRCm39) N5Y probably benign Het
Spats2 C A 15: 99,110,168 (GRCm39) P522T possibly damaging Het
Stkld1 A T 2: 26,839,352 (GRCm39) E339D probably benign Het
Tbc1d9 A G 8: 83,960,872 (GRCm39) T241A probably damaging Het
Tie1 A G 4: 118,333,477 (GRCm39) probably benign Het
Trak1 G C 9: 121,301,973 (GRCm39) V910L probably damaging Het
Trmt1l T C 1: 151,324,131 (GRCm39) V326A probably benign Het
Tshr A G 12: 91,472,057 (GRCm39) T136A probably damaging Het
Ube3c A G 5: 29,803,936 (GRCm39) T180A possibly damaging Het
Unc13a A C 8: 72,087,302 (GRCm39) F1482V probably damaging Het
Unc79 A G 12: 103,025,777 (GRCm39) E388G probably damaging Het
Ush2a A T 1: 188,697,043 (GRCm39) D5167V probably damaging Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Wdfy4 G A 14: 32,884,708 (GRCm39) R65C probably null Het
Zcchc9 T C 13: 91,945,368 (GRCm39) I72V probably benign Het
Zfc3h1 G T 10: 115,259,379 (GRCm39) L1650F possibly damaging Het
Zzz3 A G 3: 152,134,040 (GRCm39) D366G possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCGAACTCCAGTGAGACAGAAGATGAA -3'
(R):5'- ccataacatgcacatgcatacaTGAGC -3'

Sequencing Primer
(F):5'- GATGAATACCATGTCCCGCTC -3'
(R):5'- tcctcctgcctctgtctc -3'
Posted On 2013-07-11