Incidental Mutation 'R0067:Ticrr'
ID59644
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
MMRRC Submission 038358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0067 (G1)
Quality Score185
Status Validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79677410 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 622 (D622V)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: D622V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: D622V

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: D622V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: D622V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Pbk G A 14: 65,815,226 V173I possibly damaging Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Scamp1 T C 13: 94,204,150 Y237C probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Skiv2l2 C T 13: 112,886,862 V727I probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Tie1 A G 4: 118,476,280 probably benign Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Unc79 A G 12: 103,059,518 E388G probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 unclassified probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCGAACTCCAGTGAGACAGAAGATGAA -3'
(R):5'- ccataacatgcacatgcatacaTGAGC -3'

Sequencing Primer
(F):5'- GATGAATACCATGTCCCGCTC -3'
(R):5'- tcctcctgcctctgtctc -3'
Posted On2013-07-11