Incidental Mutation 'R7739:Trim39'
ID596458
Institutional Source Beutler Lab
Gene Symbol Trim39
Ensembl Gene ENSMUSG00000045409
Gene Nametripartite motif-containing 39
SynonymsRnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36258873-36272247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36260504 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 454 (D454G)
Ref Sequence ENSEMBL: ENSMUSP00000133298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025319] [ENSMUST00000042717] [ENSMUST00000077535] [ENSMUST00000113706] [ENSMUST00000172573] [ENSMUST00000173369] [ENSMUST00000173665]
Predicted Effect probably benign
Transcript: ENSMUST00000025319
SMART Domains Protein: ENSMUSP00000025319
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 13 96 1.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042717
AA Change: D446G

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: D446G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077535
SMART Domains Protein: ENSMUSP00000076739
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113706
AA Change: D446G

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: D446G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172573
SMART Domains Protein: ENSMUSP00000133400
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 1 48 4.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173369
AA Change: D454G

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: D454G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 314 367 1.23e-27 SMART
SPRY 368 493 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173665
SMART Domains Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

DomainStartEndE-ValueType
BBOX 1 40 5.81e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp13a4 A G 16: 29,456,601 I355T Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Fgf20 A G 8: 40,279,896 V167A probably damaging Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lonp1 T C 17: 56,626,620 D85G probably benign Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Polr1a T C 6: 71,954,835 I966T possibly damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf103 T A 6: 71,509,479 S365T possibly damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Trim39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Trim39 APN 17 36263963 splice site probably benign
IGL01462:Trim39 APN 17 36263725 splice site probably benign
IGL02243:Trim39 APN 17 36260384 missense probably damaging 1.00
IGL03390:Trim39 APN 17 36260571 missense probably damaging 0.99
PIT4305001:Trim39 UTSW 17 36268970 missense possibly damaging 0.93
R0458:Trim39 UTSW 17 36261512 missense probably damaging 1.00
R0569:Trim39 UTSW 17 36263731 missense probably benign 0.36
R1565:Trim39 UTSW 17 36268854 missense probably damaging 1.00
R1769:Trim39 UTSW 17 36263940 missense probably damaging 1.00
R1969:Trim39 UTSW 17 36268753 missense probably benign 0.01
R2009:Trim39 UTSW 17 36263754 missense possibly damaging 0.92
R2568:Trim39 UTSW 17 36269164 unclassified probably benign
R5206:Trim39 UTSW 17 36260490 missense probably damaging 1.00
R5443:Trim39 UTSW 17 36260753 missense probably damaging 1.00
R6481:Trim39 UTSW 17 36268662 missense probably benign 0.03
R7132:Trim39 UTSW 17 36260655 missense probably benign 0.25
R7563:Trim39 UTSW 17 36260915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGACTGGAACCACGGAG -3'
(R):5'- TGACTCCACTTCCTGAGACTG -3'

Sequencing Primer
(F):5'- CCAAGATATTCTAGCAGGCCAGTTAG -3'
(R):5'- ACTTCCTGAGACTGGCTACTGG -3'
Posted On2019-11-26