Incidental Mutation 'R7739:Lonp1'
ID596459
Institutional Source Beutler Lab
Gene Symbol Lonp1
Ensembl Gene ENSMUSG00000041168
Gene Namelon peptidase 1, mitochondrial
Synonyms1200017E13Rik, LON, Prss15
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7739 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56614301-56626903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56626620 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000041814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000112979]
Predicted Effect probably benign
Transcript: ENSMUST00000047226
AA Change: D85G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: D85G

DomainStartEndE-ValueType
LON 111 357 3.95e-62 SMART
low complexity region 389 404 N/A INTRINSIC
AAA 504 649 1.81e-14 SMART
Pfam:Lon_C 725 938 1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112979
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik T A 1: 177,743,262 I54K probably damaging Het
9130401M01Rik C A 15: 58,022,479 A336S probably benign Het
Abca8b A G 11: 109,974,591 S347P probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Atp13a4 A G 16: 29,456,601 I355T Het
Atp2a2 G A 5: 122,469,705 T247I probably damaging Het
Atp2b1 T A 10: 99,001,365 D555E probably benign Het
Aurkb G T 11: 69,048,232 G94* probably null Het
B130006D01Rik A T 11: 95,726,160 H37L unknown Het
Cabin1 A G 10: 75,658,658 L1629P probably damaging Het
Ccdc80 A C 16: 45,095,823 D314A probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Chd9 T C 8: 91,035,025 L2246P probably damaging Het
Cpsf1 T A 15: 76,600,311 M657L probably benign Het
Dmtf1 A G 5: 9,140,453 V87A probably damaging Het
Drd5 G T 5: 38,320,078 W138L probably damaging Het
Dspp G A 5: 104,178,146 D792N unknown Het
Fat2 C A 11: 55,281,131 E2919* probably null Het
Fgf20 A G 8: 40,279,896 V167A probably damaging Het
Gm597 T A 1: 28,777,608 T448S possibly damaging Het
Gm8251 G A 1: 44,056,418 T1840I possibly damaging Het
Grm5 T C 7: 88,130,058 V934A possibly damaging Het
Gtf3c3 G T 1: 54,405,039 A730D possibly damaging Het
H2-T24 A G 17: 36,014,591 V335A probably benign Het
Havcr2 T G 11: 46,456,557 N120K probably damaging Het
Hmcn2 T C 2: 31,458,026 F4895L possibly damaging Het
Igsf3 T C 3: 101,435,531 Y475H probably damaging Het
Lrrc49 T C 9: 60,593,692 S657G probably benign Het
Lrrk2 T A 15: 91,700,613 Y382N probably damaging Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mtf1 T A 4: 124,824,288 C260S probably damaging Het
Naa35 A G 13: 59,599,784 D110G probably damaging Het
Npas3 A T 12: 54,068,718 T808S probably damaging Het
Olfr76 A G 19: 12,120,545 W56R probably damaging Het
Pax9 A T 12: 56,700,099 H240L probably benign Het
Pik3c2a T C 7: 116,394,294 T413A probably benign Het
Pik3r1 A G 13: 101,709,697 V127A probably benign Het
Pik3r5 A G 11: 68,490,498 E170G probably damaging Het
Polr1a T C 6: 71,954,835 I966T possibly damaging Het
Prelid2 A G 18: 41,912,368 probably null Het
Rab29 T A 1: 131,872,185 M166K probably damaging Het
Rab2b T C 14: 52,266,260 E135G probably damaging Het
Rnf103 T A 6: 71,509,479 S365T possibly damaging Het
Rnf213 G A 11: 119,410,861 E387K Het
Sh3d19 T C 3: 86,123,731 V734A probably benign Het
Ssbp1 T G 6: 40,477,980 N124K probably damaging Het
Tbc1d31 C T 15: 57,936,098 R227* probably null Het
Tcerg1 A G 18: 42,523,974 T174A unknown Het
Tenm2 T C 11: 36,069,561 S980G possibly damaging Het
Trim30a T C 7: 104,430,179 I156M possibly damaging Het
Trim39 T C 17: 36,260,504 D454G possibly damaging Het
Trpc7 A T 13: 56,773,766 *863K probably null Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Vmn1r33 C T 6: 66,612,373 D66N probably benign Het
Vmn2r8 A T 5: 108,802,177 I268N probably damaging Het
Vmn2r91 A C 17: 18,135,818 E582D probably benign Het
Vtcn1 T C 3: 100,883,895 F83S probably damaging Het
Wdr81 G T 11: 75,441,985 D684E Het
Wipi1 A G 11: 109,579,709 S295P probably damaging Het
Zfp27 A T 7: 29,894,274 H755Q possibly damaging Het
Zfp963 A G 8: 69,742,883 F307L possibly damaging Het
Other mutations in Lonp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lonp1 APN 17 56619265 missense probably damaging 1.00
IGL00934:Lonp1 APN 17 56614683 missense probably benign 0.21
IGL01065:Lonp1 APN 17 56615500 unclassified probably benign
IGL01343:Lonp1 APN 17 56615586 missense possibly damaging 0.93
IGL01734:Lonp1 APN 17 56616026 missense probably damaging 1.00
IGL02141:Lonp1 APN 17 56615086 missense probably benign 0.19
IGL02979:Lonp1 APN 17 56621940 missense probably benign 0.02
chaney UTSW 17 56622515 missense probably damaging 1.00
Karloff UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0015:Lonp1 UTSW 17 56618406 missense probably benign
R0863:Lonp1 UTSW 17 56618331 missense probably damaging 1.00
R1343:Lonp1 UTSW 17 56620272 missense probably damaging 1.00
R1735:Lonp1 UTSW 17 56614956 missense probably damaging 1.00
R1975:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1976:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R1977:Lonp1 UTSW 17 56615068 missense possibly damaging 0.69
R2484:Lonp1 UTSW 17 56614659 missense probably damaging 1.00
R2895:Lonp1 UTSW 17 56615562 missense probably damaging 1.00
R3123:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3125:Lonp1 UTSW 17 56626488 missense possibly damaging 0.79
R3429:Lonp1 UTSW 17 56618337 missense probably damaging 1.00
R3726:Lonp1 UTSW 17 56618310 unclassified probably benign
R3767:Lonp1 UTSW 17 56621952 missense possibly damaging 0.80
R4618:Lonp1 UTSW 17 56622511 missense probably benign 0.03
R4859:Lonp1 UTSW 17 56626587 missense probably benign 0.00
R4951:Lonp1 UTSW 17 56620335 missense possibly damaging 0.64
R5208:Lonp1 UTSW 17 56617793 missense probably damaging 1.00
R5620:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5621:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R5622:Lonp1 UTSW 17 56620263 missense probably benign 0.05
R6131:Lonp1 UTSW 17 56614457 missense probably benign 0.01
R6377:Lonp1 UTSW 17 56621961 missense possibly damaging 0.90
R6692:Lonp1 UTSW 17 56619230 missense probably damaging 1.00
R7052:Lonp1 UTSW 17 56626549 missense probably benign 0.31
R7131:Lonp1 UTSW 17 56617814 missense probably damaging 1.00
R7295:Lonp1 UTSW 17 56622495 missense possibly damaging 0.70
R7792:Lonp1 UTSW 17 56622515 missense probably damaging 1.00
R8307:Lonp1 UTSW 17 56626573 missense probably benign 0.01
R8546:Lonp1 UTSW 17 56626702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTTAGACGCGAGGGAGC -3'
(R):5'- AGAACATCCTTCATCGGGCC -3'

Sequencing Primer
(F):5'- AGCTGAGAGACCACTCGG -3'
(R):5'- TCTGAGCCTTGAACCACGC -3'
Posted On2019-11-26