Incidental Mutation 'R7740:2310035C23Rik'
ID596465
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R7740 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105731261 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 914 (V914A)
Ref Sequence ENSEMBL: ENSMUSP00000039178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably damaging
Transcript: ENSMUST00000039173
AA Change: V914A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: V914A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086721
AA Change: V914A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: V914A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably benign
Transcript: ENSMUST00000186807
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190501
AA Change: V890A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: V890A

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
R7209:2310035C23Rik UTSW 1 105750357 missense probably damaging 1.00
R7284:2310035C23Rik UTSW 1 105734583 missense probably benign 0.01
R7292:2310035C23Rik UTSW 1 105721416 critical splice donor site probably null
R7534:2310035C23Rik UTSW 1 105741023 missense probably benign 0.01
R8036:2310035C23Rik UTSW 1 105678177 missense probably damaging 1.00
Z1176:2310035C23Rik UTSW 1 105719615 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTGTGTGCTAATGCCACTTCAG -3'
(R):5'- AGACAAGCTGACTGCAGAATC -3'

Sequencing Primer
(F):5'- GCCACTTCAGAAGTATTAAGTTGTGG -3'
(R):5'- TGACTGCAGAATCATAAACCAATGG -3'
Posted On2019-11-26