Incidental Mutation 'R7740:Cyp4a14'
ID 596482
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 045796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7740 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115350806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 156 (V156D)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: V156D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V156D

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,885,370 (GRCm39) Q163* probably null Het
Anxa6 T A 11: 54,898,725 (GRCm39) T150S probably damaging Het
Bpifb6 T A 2: 153,744,929 (GRCm39) L45Q probably damaging Het
Brwd1 T C 16: 95,828,568 (GRCm39) D1121G probably damaging Het
C1ql3 A G 2: 13,015,483 (GRCm39) I59T possibly damaging Het
Ccdc80 A G 16: 44,924,888 (GRCm39) H674R possibly damaging Het
Cdhr1 T G 14: 36,811,337 (GRCm39) E258A probably damaging Het
Ces2g T A 8: 105,692,962 (GRCm39) F333L probably damaging Het
Chn2 C T 6: 54,277,156 (GRCm39) T445I probably benign Het
Cpe T C 8: 65,050,562 (GRCm39) D382G possibly damaging Het
Crb1 T A 1: 139,165,428 (GRCm39) I960L probably benign Het
Ddx23 A T 15: 98,556,315 (GRCm39) M1K probably null Het
Dnajc7 T C 11: 100,482,387 (GRCm39) I202V probably benign Het
Dsn1 T A 2: 156,839,636 (GRCm39) D255V possibly damaging Het
Dvl3 A T 16: 20,346,000 (GRCm39) probably null Het
Epm2a A G 10: 11,266,684 (GRCm39) D143G possibly damaging Het
Erc1 T A 6: 119,738,149 (GRCm39) M565L probably benign Het
Fancm T C 12: 65,173,321 (GRCm39) C1878R possibly damaging Het
Gapvd1 T C 2: 34,590,834 (GRCm39) E946G probably damaging Het
Gm9195 C T 14: 72,678,113 (GRCm39) R2352K possibly damaging Het
Greb1 C A 12: 16,790,122 (GRCm39) probably benign Het
Haus5 G A 7: 30,362,678 (GRCm39) A44V possibly damaging Het
Herc4 A G 10: 63,105,457 (GRCm39) Y146C probably benign Het
Herc6 T G 6: 57,636,802 (GRCm39) probably null Het
Hivep2 G T 10: 14,003,414 (GRCm39) G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 (GRCm39) G425V probably damaging Het
Igkv1-110 C T 6: 68,247,974 (GRCm39) L28F probably benign Het
Il21r T A 7: 125,231,727 (GRCm39) L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Krtap5-2 C T 7: 141,728,699 (GRCm39) C149Y unknown Het
Lingo2 T A 4: 35,709,248 (GRCm39) N244I probably damaging Het
Lrrk2 C T 15: 91,651,527 (GRCm39) R1728C probably damaging Het
Macf1 A G 4: 123,578,096 (GRCm39) probably benign Het
Malrd1 G A 2: 15,619,026 (GRCm39) V297I not run Het
Mars1 T A 10: 127,136,444 (GRCm39) E460D probably benign Het
Nr1i3 A G 1: 171,044,396 (GRCm39) I174V probably benign Het
Odf2 C T 2: 29,820,636 (GRCm39) T814M probably damaging Het
Or10q1 T C 19: 13,727,328 (GRCm39) V286A probably benign Het
Or4k1 T C 14: 50,377,803 (GRCm39) M98V probably benign Het
Or4k52 A T 2: 111,610,793 (GRCm39) I43F possibly damaging Het
Pcdhga8 T C 18: 37,860,470 (GRCm39) S509P probably benign Het
Pdzd2 A G 15: 12,374,102 (GRCm39) L2011S probably benign Het
Pole T A 5: 110,478,907 (GRCm39) S1930T probably benign Het
Poteg T A 8: 27,952,052 (GRCm39) probably null Het
Ptprk T A 10: 28,372,920 (GRCm39) C724S probably damaging Het
Rabgap1l T C 1: 160,509,673 (GRCm39) E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 (GRCm39) R642L probably benign Het
Relch T C 1: 105,658,986 (GRCm39) V914A probably damaging Het
S1pr4 A T 10: 81,334,855 (GRCm39) Y206* probably null Het
Sim2 A G 16: 93,915,819 (GRCm39) I261V probably benign Het
Slc22a12 C A 19: 6,587,199 (GRCm39) A448S probably benign Het
Slc4a2 A G 5: 24,636,666 (GRCm39) probably null Het
Slc6a7 T C 18: 61,133,495 (GRCm39) E567G possibly damaging Het
St6gal1 T C 16: 23,139,785 (GRCm39) probably benign Het
Syne3 T C 12: 104,920,546 (GRCm39) K550R probably benign Het
Tekt1 T A 11: 72,250,544 (GRCm39) T51S probably benign Het
Tm9sf4 T A 2: 153,050,663 (GRCm39) V640E probably damaging Het
Tnfsf8 G T 4: 63,752,683 (GRCm39) H127Q possibly damaging Het
Tomm20 A G 8: 127,666,633 (GRCm39) L80S probably damaging Het
Top2a T C 11: 98,884,640 (GRCm39) D1526G probably benign Het
Trmt1l T C 1: 151,316,639 (GRCm39) V200A possibly damaging Het
Trpa1 A G 1: 14,982,625 (GRCm39) V77A possibly damaging Het
Vmn2r12 A T 5: 109,239,615 (GRCm39) V316D probably damaging Het
Vmn2r14 A T 5: 109,368,324 (GRCm39) L223M probably benign Het
Zfp2 T C 11: 50,791,605 (GRCm39) H146R probably damaging Het
Zfp52 T C 17: 21,781,252 (GRCm39) S367P probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTATCTGAAGTCTGTGGC -3'
(R):5'- TGAATGTAACCAAATGATTCCAGGG -3'

Sequencing Primer
(F):5'- CCAATTTATGCATTTGTGGGAGACTC -3'
(R):5'- GTAACCAAATGATTCCAGGGGTACTC -3'
Posted On 2019-11-26