Mutagenetix > Incidental Mutations

Incidental Mutation 'R7740:Macf1'

596483

Institutional Source

Beutler Lab

Gene Symbol

Macf1

Ensembl Gene

ENSMUSG00000028649

Gene Name

microtubule-actin crosslinking factor 1

Synonyms

trabeculin alpha, Acf7, Aclp7

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7740 (G1)

Quality Score

164.009

Status

Validated

Chromosome

Chromosomal Location

123349633-123684360 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to G at 123684303 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106224]

Predicted Effect

probably benign
Transcript: ENSMUST00000082108

SMART Domains

Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	4e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
SPEC	1550	1658	3.94e-3	SMART
SPEC	1818	1928	4.03e-9	SMART
SPEC	1935	2041	1.75e-9	SMART
SPEC	2048	2150	5.57e-3	SMART
SPEC	2157	2256	4.56e0	SMART
SPEC	2263	2394	3.46e-1	SMART
SPEC	2401	2506	1.29e-7	SMART
SPEC	2513	2617	1.19e-2	SMART
SPEC	2624	2727	2.7e-1	SMART
SPEC	2734	2837	4.99e-14	SMART
SPEC	2844	2944	1.9e-5	SMART
SPEC	2951	3057	2.83e0	SMART
SPEC	3060	3162	2.14e-4	SMART
SPEC	3169	3273	3.01e-8	SMART
SPEC	3280	3382	4.48e-16	SMART
SPEC	3389	3491	1.26e-10	SMART
SPEC	3498	3600	2.26e-3	SMART
SPEC	3607	3709	4.29e-4	SMART
SPEC	3716	3817	9.99e-14	SMART
SPEC	3824	3930	5.79e-2	SMART
SPEC	3937	4039	6.59e-14	SMART
SPEC	4046	4149	3.7e-17	SMART
SPEC	4156	4258	1.16e-23	SMART
SPEC	4265	4368	3.58e-15	SMART
SPEC	4375	4477	2.61e-17	SMART
SPEC	4484	4587	9.38e-19	SMART
SPEC	4594	4695	2.29e-22	SMART
SPEC	4702	4804	4.99e-14	SMART
SPEC	4811	4941	1.45e-10	SMART
EFh	4979	5007	5.08e-3	SMART
EFh	5015	5043	1.17e-2	SMART
GAS2	5054	5132	8.5e-54	SMART
low complexity region	5154	5199	N/A	INTRINSIC
low complexity region	5248	5273	N/A	INTRINSIC
low complexity region	5290	5302	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084301

SMART Domains

Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	2.8e-30	SMART
CH	196	293	3.6e-26	SMART
SPEC	317	420	2.6e-2	SMART
SPEC	583	680	2.7e-11	SMART
SPEC	683	783	3.6e-7	SMART
Blast:SPEC	790	955	5e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	1.5e-2	SMART
SPEC	1425	1533	6.9e-10	SMART
PLEC	1530	1576	5.3e-6	SMART
PLEC	1577	1614	1.2e-2	SMART
PLEC	1616	1653	8.7e-2	SMART
PLEC	1654	1691	8.3e-2	SMART
PLEC	1695	1729	1.3e-1	SMART
PLEC	1731	1767	1.4e-4	SMART
PLEC	1768	1805	2e-12	SMART
PLEC	1808	1843	5.2e-4	SMART
PLEC	1844	1881	4e-2	SMART
PLEC	1884	1919	1.9e0	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	4.5e-6	SMART
PLEC	2347	2388	1.7e-7	SMART
PLEC	2389	2426	1.2e-5	SMART
PLEC	2447	2484	6.3e-3	SMART
PLEC	2485	2522	2.1e-4	SMART
PLEC	2523	2561	1.5e-1	SMART
PLEC	2586	2633	3.1e-1	SMART
PLEC	2671	2708	6.5e-10	SMART
PLEC	2709	2746	2.3e-3	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3683	7.1e-3	SMART
SPEC	3841	3951	2.6e-11	SMART
SPEC	3958	4064	1.1e-11	SMART
SPEC	4071	4173	3.6e-5	SMART
SPEC	4180	4279	2.9e-2	SMART
SPEC	4286	4417	2.2e-3	SMART
SPEC	4424	4529	8.2e-10	SMART
SPEC	4536	4640	7.4e-5	SMART
SPEC	4647	4750	1.7e-3	SMART
SPEC	4757	4860	3.2e-16	SMART
SPEC	4867	4967	1.2e-7	SMART
SPEC	4974	5080	1.8e-2	SMART
SPEC	5083	5185	1.3e-6	SMART
SPEC	5192	5296	2e-10	SMART
SPEC	5303	5405	2.8e-18	SMART
SPEC	5412	5514	7.7e-13	SMART
SPEC	5521	5623	1.5e-5	SMART
SPEC	5630	5732	2.7e-6	SMART
SPEC	5739	5840	6.1e-16	SMART
SPEC	5847	5953	3.6e-4	SMART
SPEC	5960	6062	4.1e-16	SMART
SPEC	6069	6172	2.4e-19	SMART
SPEC	6179	6281	7.6e-26	SMART
SPEC	6288	6391	2.2e-17	SMART
SPEC	6398	6500	1.6e-19	SMART
SPEC	6507	6610	5.7e-21	SMART
SPEC	6617	6718	1.5e-24	SMART
SPEC	6725	6827	3.2e-16	SMART
SPEC	6834	6964	9.4e-13	SMART
EFh	7002	7030	2.4e-5	SMART
EFh	7038	7066	5.8e-5	SMART
GAS2	7077	7155	5.5e-56	SMART
low complexity region	7177	7222	N/A	INTRINSIC
low complexity region	7271	7296	N/A	INTRINSIC
low complexity region	7313	7325	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097897

SMART Domains

Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	4e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
PLEC	1530	1576	8.58e-4	SMART
PLEC	1577	1614	1.9e0	SMART
PLEC	1616	1653	1.38e1	SMART
PLEC	1654	1691	1.3e1	SMART
PLEC	1695	1729	2.1e1	SMART
PLEC	1731	1767	2.23e-2	SMART
PLEC	1768	1805	3.32e-10	SMART
PLEC	1808	1843	8.32e-2	SMART
PLEC	1844	1881	6.42e0	SMART
PLEC	1884	1919	3e2	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	6.97e-4	SMART
PLEC	2347	2388	2.68e-5	SMART
PLEC	2389	2426	1.84e-3	SMART
PLEC	2447	2484	1.01e0	SMART
PLEC	2485	2522	3.38e-2	SMART
PLEC	2523	2561	2.39e1	SMART
PLEC	2586	2633	4.99e1	SMART
PLEC	2671	2708	1.05e-7	SMART
PLEC	2709	2746	3.57e-1	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3685	3.94e-3	SMART
SPEC	3845	3955	4.03e-9	SMART
SPEC	3962	4068	1.75e-9	SMART
SPEC	4075	4177	5.57e-3	SMART
SPEC	4184	4283	4.56e0	SMART
SPEC	4290	4421	3.46e-1	SMART
SPEC	4428	4533	1.29e-7	SMART
SPEC	4540	4644	1.19e-2	SMART
SPEC	4651	4754	2.7e-1	SMART
SPEC	4761	4864	4.99e-14	SMART
SPEC	4871	4971	1.9e-5	SMART
SPEC	4978	5084	2.83e0	SMART
SPEC	5087	5189	2.14e-4	SMART
SPEC	5196	5300	3.01e-8	SMART
SPEC	5307	5409	4.48e-16	SMART
SPEC	5416	5518	1.26e-10	SMART
SPEC	5525	5627	2.26e-3	SMART
SPEC	5634	5736	4.29e-4	SMART
SPEC	5743	5844	9.99e-14	SMART
SPEC	5851	5957	5.79e-2	SMART
SPEC	5964	6066	6.59e-14	SMART
SPEC	6073	6176	3.7e-17	SMART
SPEC	6183	6285	1.16e-23	SMART
SPEC	6292	6395	3.58e-15	SMART
SPEC	6402	6504	2.61e-17	SMART
SPEC	6511	6614	9.38e-19	SMART
SPEC	6621	6722	2.29e-22	SMART
SPEC	6729	6831	4.99e-14	SMART
SPEC	6838	6968	1.45e-10	SMART
EFh	7006	7034	5.08e-3	SMART
EFh	7042	7070	1.17e-2	SMART
GAS2	7081	7159	8.5e-54	SMART
low complexity region	7181	7226	N/A	INTRINSIC
low complexity region	7275	7300	N/A	INTRINSIC
low complexity region	7317	7329	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106224

SMART Domains

Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	5e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
PLEC	1530	1576	8.58e-4	SMART
PLEC	1577	1614	1.9e0	SMART
PLEC	1616	1653	1.38e1	SMART
PLEC	1654	1691	1.3e1	SMART
PLEC	1695	1729	2.1e1	SMART
PLEC	1731	1767	2.23e-2	SMART
PLEC	1768	1805	3.32e-10	SMART
PLEC	1808	1843	8.32e-2	SMART
PLEC	1844	1881	6.42e0	SMART
PLEC	1884	1919	3e2	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	6.97e-4	SMART
PLEC	2347	2388	2.68e-5	SMART
PLEC	2389	2426	1.84e-3	SMART
PLEC	2447	2484	1.01e0	SMART
PLEC	2485	2522	3.38e-2	SMART
PLEC	2523	2561	2.39e1	SMART
PLEC	2586	2633	4.99e1	SMART
PLEC	2671	2708	1.05e-7	SMART
PLEC	2709	2746	3.57e-1	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3685	3.94e-3	SMART
SPEC	3845	3955	4.03e-9	SMART
SPEC	3962	4068	1.75e-9	SMART
SPEC	4075	4177	5.57e-3	SMART
SPEC	4184	4283	4.56e0	SMART
SPEC	4290	4421	3.46e-1	SMART
SPEC	4428	4533	1.29e-7	SMART
SPEC	4540	4642	9.34e-2	SMART
SPEC	4649	4752	2.7e-1	SMART
SPEC	4759	4862	4.99e-14	SMART
SPEC	4869	4969	1.9e-5	SMART
SPEC	4976	5082	2.83e0	SMART
SPEC	5085	5187	2.14e-4	SMART
SPEC	5194	5298	3.01e-8	SMART
SPEC	5305	5407	4.48e-16	SMART
SPEC	5414	5516	1.26e-10	SMART
SPEC	5523	5625	2.26e-3	SMART
SPEC	5632	5734	4.29e-4	SMART
SPEC	5741	5842	9.99e-14	SMART
SPEC	5849	5955	5.79e-2	SMART
SPEC	5962	6064	6.59e-14	SMART
SPEC	6071	6174	3.7e-17	SMART
SPEC	6181	6283	1.16e-23	SMART
SPEC	6290	6393	3.58e-15	SMART
SPEC	6400	6502	2.61e-17	SMART
SPEC	6509	6612	9.38e-19	SMART
SPEC	6619	6720	2.29e-22	SMART
SPEC	6727	6829	4.99e-14	SMART
SPEC	6836	6966	1.45e-10	SMART
EFh	7004	7032	5.08e-3	SMART
EFh	7040	7068	1.17e-2	SMART
GAS2	7079	7157	8.5e-54	SMART
low complexity region	7179	7224	N/A	INTRINSIC
low complexity region	7273	7298	N/A	INTRINSIC
low complexity region	7315	7327	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,731,261	V914A	probably damaging	Het
4930522L14Rik	G	A	5: 109,737,504	Q163*	probably null	Het
Anxa6	T	A	11: 55,007,899	T150S	probably damaging	Het
Bpifb6	T	A	2: 153,903,009	L45Q	probably damaging	Het
Brwd1	T	C	16: 96,027,368	D1121G	probably damaging	Het
C1ql3	A	G	2: 13,010,672	I59T	possibly damaging	Het
Ccdc80	A	G	16: 45,104,525	H674R	possibly damaging	Het
Cdhr1	T	G	14: 37,089,380	E258A	probably damaging	Het
Ces2g	T	A	8: 104,966,330	F333L	probably damaging	Het
Chn2	C	T	6: 54,300,171	T445I	probably benign	Het
Cpe	T	C	8: 64,597,528	D382G	possibly damaging	Het
Crb1	T	A	1: 139,237,690	I960L	probably benign	Het
Cyp4a14	A	T	4: 115,493,609	V156D	probably damaging	Het
Ddx23	A	T	15: 98,658,434	M1K	probably null	Het
Dnajc7	T	C	11: 100,591,561	I202V	probably benign	Het
Dsn1	T	A	2: 156,997,716	D255V	possibly damaging	Het
Dvl3	A	T	16: 20,527,250		probably null	Het
Epm2a	A	G	10: 11,390,940	D143G	possibly damaging	Het
Erc1	T	A	6: 119,761,188	M565L	probably benign	Het
Fancm	T	C	12: 65,126,547	C1878R	possibly damaging	Het
Gapvd1	T	C	2: 34,700,822	E946G	probably damaging	Het
Gm9195	C	T	14: 72,440,673	R2352K	possibly damaging	Het
Greb1	C	A	12: 16,740,121		probably benign	Het
Haus5	G	A	7: 30,663,253	A44V	possibly damaging	Het
Herc4	A	G	10: 63,269,678	Y146C	probably benign	Het
Herc6	T	G	6: 57,659,817		probably null	Het
Hivep2	G	T	10: 14,127,670	G4V	probably damaging	Het
Hsdl2	G	T	4: 59,612,724	G425V	probably damaging	Het
Igkv1-110	C	T	6: 68,270,990	L28F	probably benign	Het
Il21r	T	A	7: 125,632,555	L385Q	possibly damaging	Het
Krtap5-1	ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG	ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG	7: 142,296,596		probably benign	Het
Krtap5-2	C	T	7: 142,174,962	C149Y	unknown	Het
Lingo2	T	A	4: 35,709,248	N244I	probably damaging	Het
Lrrk2	C	T	15: 91,767,324	R1728C	probably damaging	Het
Malrd1	G	A	2: 15,614,215	V297I	not run	Het
Mars	T	A	10: 127,300,575	E460D	probably benign	Het
Nr1i3	A	G	1: 171,216,827	I174V	probably benign	Het
Odf2	C	T	2: 29,930,624	T814M	probably damaging	Het
Olfr1302	A	T	2: 111,780,448	I43F	possibly damaging	Het
Olfr1494	T	C	19: 13,749,964	V286A	probably benign	Het
Olfr728	T	C	14: 50,140,346	M98V	probably benign	Het
Pcdhga8	T	C	18: 37,727,417	S509P	probably benign	Het
Pdzd2	A	G	15: 12,374,016	L2011S	probably benign	Het
Pole	T	A	5: 110,331,041	S1930T	probably benign	Het
Poteg	T	A	8: 27,462,024		probably null	Het
Ptprk	T	A	10: 28,496,924	C724S	probably damaging	Het
Rabgap1l	T	C	1: 160,682,103	E468G	probably benign	Het
Rbm12b1	G	T	4: 12,145,954	R642L	probably benign	Het
S1pr4	A	T	10: 81,499,021	Y206*	probably null	Het
Sim2	A	G	16: 94,114,960	I261V	probably benign	Het
Slc22a12	C	A	19: 6,537,169	A448S	probably benign	Het
Slc4a2	A	G	5: 24,431,668		probably null	Het
Slc6a7	T	C	18: 61,000,423	E567G	possibly damaging	Het
St6gal1	T	C	16: 23,321,035		probably benign	Het
Syne3	T	C	12: 104,954,287	K550R	probably benign	Het
Tekt1	T	A	11: 72,359,718	T51S	probably benign	Het
Tm9sf4	T	A	2: 153,208,743	V640E	probably damaging	Het
Tnfsf8	G	T	4: 63,834,446	H127Q	possibly damaging	Het
Tomm20	A	G	8: 126,939,883	L80S	probably damaging	Het
Top2a	T	C	11: 98,993,814	D1526G	probably benign	Het
Trmt1l	T	C	1: 151,440,888	V200A	possibly damaging	Het
Trpa1	A	G	1: 14,912,401	V77A	possibly damaging	Het
Vmn2r12	A	T	5: 109,091,749	V316D	probably damaging	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Zfp2	T	C	11: 50,900,778	H146R	probably damaging	Het
Zfp52	T	C	17: 21,560,990	S367P	probably damaging	Het

Other mutations in Macf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Macf1	APN	4	123382122	missense	probably damaging	0.99
IGL01293:Macf1	APN	4	123471311	missense	probably benign	0.00
IGL01307:Macf1	APN	4	123383129	missense	probably damaging	1.00
IGL01314:Macf1	APN	4	123486720	missense	probably damaging	1.00
IGL01321:Macf1	APN	4	123440774	missense	probably damaging	1.00
IGL01327:Macf1	APN	4	123509912	missense	probably benign	0.20
IGL01365:Macf1	APN	4	123391169	missense	probably damaging	1.00
IGL01465:Macf1	APN	4	123490721	missense	probably benign	0.00
IGL01527:Macf1	APN	4	123493160	missense	possibly damaging	0.93
IGL01533:Macf1	APN	4	123473873	missense	probably damaging	1.00
IGL01539:Macf1	APN	4	123395908	splice site	probably benign
IGL01543:Macf1	APN	4	123401457	missense	probably damaging	1.00
IGL01553:Macf1	APN	4	123493163	nonsense	probably null
IGL01558:Macf1	APN	4	123453005	missense	probably benign	0.00
IGL01633:Macf1	APN	4	123502171	missense	probably damaging	0.99
IGL01684:Macf1	APN	4	123465930	missense	probably damaging	1.00
IGL01715:Macf1	APN	4	123391086	missense	probably damaging	1.00
IGL01844:Macf1	APN	4	123440692	missense	probably benign	0.34
IGL01870:Macf1	APN	4	123474113	missense	probably damaging	0.99
IGL01916:Macf1	APN	4	123441630	missense	probably damaging	1.00
IGL01916:Macf1	APN	4	123476037	missense	probably damaging	1.00
IGL01923:Macf1	APN	4	123380444	missense	possibly damaging	0.46
IGL02017:Macf1	APN	4	123499931	missense	probably damaging	1.00
IGL02022:Macf1	APN	4	123391049	critical splice donor site	probably null
IGL02084:Macf1	APN	4	123432603	missense	probably benign	0.02
IGL02084:Macf1	APN	4	123459374	missense	probably damaging	1.00
IGL02142:Macf1	APN	4	123472049	missense	probably benign	0.11
IGL02151:Macf1	APN	4	123371766	splice site	probably benign
IGL02164:Macf1	APN	4	123480272	missense	probably benign	0.03
IGL02174:Macf1	APN	4	123491794	missense	probably damaging	1.00
IGL02229:Macf1	APN	4	123509826	missense	probably damaging	1.00
IGL02277:Macf1	APN	4	123486704	missense	probably damaging	1.00
IGL02283:Macf1	APN	4	123471375	missense	probably benign	0.01
IGL02314:Macf1	APN	4	123444837	missense	probably damaging	0.99
IGL02327:Macf1	APN	4	123471730	missense	probably benign	0.06
IGL02348:Macf1	APN	4	123512866	missense	probably damaging	1.00
IGL02441:Macf1	APN	4	123387236	missense	probably damaging	1.00
IGL02585:Macf1	APN	4	123472284	missense	probably benign	0.00
IGL02602:Macf1	APN	4	123355163	missense	probably damaging	1.00
IGL03204:Macf1	APN	4	123355277	splice site	probably benign
anakex	UTSW	4	123408271	missense	probably damaging	0.97
esfuerzo	UTSW	4	123476129	missense	probably benign	0.22
Royal_flush	UTSW	4	123365355	splice site	probably null
standard	UTSW	4	123486406	missense	probably damaging	1.00
suspension	UTSW	4	123497755	missense	probably damaging	1.00
voragine	UTSW	4	123355102	missense	probably damaging	1.00
BB010:Macf1	UTSW	4	123409651	missense	probably benign	0.00
BB020:Macf1	UTSW	4	123409651	missense	probably benign	0.00
H8562:Macf1	UTSW	4	123466040	missense	probably benign	0.13
IGL03052:Macf1	UTSW	4	123387395	missense	probably damaging	1.00
N/A - 535:Macf1	UTSW	4	123473808	missense	possibly damaging	0.82
PIT4576001:Macf1	UTSW	4	123473321	missense	probably benign	0.43
R0021:Macf1	UTSW	4	123475577	missense	probably damaging	1.00
R0023:Macf1	UTSW	4	123488314	splice site	probably benign
R0023:Macf1	UTSW	4	123488314	splice site	probably benign
R0028:Macf1	UTSW	4	123382102	missense	probably damaging	1.00
R0066:Macf1	UTSW	4	123432150	nonsense	probably null
R0066:Macf1	UTSW	4	123432150	nonsense	probably null
R0067:Macf1	UTSW	4	123475248	missense	possibly damaging	0.90
R0067:Macf1	UTSW	4	123475248	missense	possibly damaging	0.90
R0078:Macf1	UTSW	4	123473868	missense	probably damaging	1.00
R0106:Macf1	UTSW	4	123408564	missense	probably benign	0.00
R0123:Macf1	UTSW	4	123432843	missense	possibly damaging	0.78
R0129:Macf1	UTSW	4	123433275	missense	probably damaging	1.00
R0134:Macf1	UTSW	4	123432843	missense	possibly damaging	0.78
R0138:Macf1	UTSW	4	123440747	missense	probably damaging	1.00
R0145:Macf1	UTSW	4	123387397	missense	probably damaging	1.00
R0195:Macf1	UTSW	4	123434916	missense	probably damaging	0.99
R0227:Macf1	UTSW	4	123399391	missense	probably benign	0.14
R0233:Macf1	UTSW	4	123450127	splice site	probably benign
R0254:Macf1	UTSW	4	123432779	missense	probably damaging	1.00
R0357:Macf1	UTSW	4	123457983	missense	probably damaging	1.00
R0398:Macf1	UTSW	4	123351017	missense	probably damaging	1.00
R0413:Macf1	UTSW	4	123472269	missense	probably benign
R0426:Macf1	UTSW	4	123483660	nonsense	probably null
R0441:Macf1	UTSW	4	123365355	splice site	probably null
R0453:Macf1	UTSW	4	123444944	missense	probably benign	0.35
R0481:Macf1	UTSW	4	123484022	splice site	probably null
R0502:Macf1	UTSW	4	123469815	missense	probably damaging	1.00
R0503:Macf1	UTSW	4	123469815	missense	probably damaging	1.00
R0519:Macf1	UTSW	4	123471320	missense	probably benign	0.03
R0543:Macf1	UTSW	4	123376378	missense	probably damaging	1.00
R0621:Macf1	UTSW	4	123380534	missense	probably damaging	1.00
R0631:Macf1	UTSW	4	123455524	nonsense	probably null
R0720:Macf1	UTSW	4	123432925	missense	probably damaging	1.00
R0730:Macf1	UTSW	4	123382530	splice site	probably benign
R0755:Macf1	UTSW	4	123369926	missense	probably damaging	0.99
R0836:Macf1	UTSW	4	123494882	critical splice donor site	probably null
R0847:Macf1	UTSW	4	123399366	missense	probably benign	0.03
R0850:Macf1	UTSW	4	123474402	missense	probably benign
R0924:Macf1	UTSW	4	123385478	missense	probably damaging	1.00
R0973:Macf1	UTSW	4	123476000	missense	possibly damaging	0.76
R1025:Macf1	UTSW	4	123473816	missense	probably damaging	1.00
R1076:Macf1	UTSW	4	123385598	missense	probably damaging	1.00
R1253:Macf1	UTSW	4	123457967	missense	probably damaging	1.00
R1301:Macf1	UTSW	4	123486658	splice site	probably benign
R1337:Macf1	UTSW	4	123476275	missense	probably benign	0.34
R1344:Macf1	UTSW	4	123433453	missense	probably damaging	0.99
R1404:Macf1	UTSW	4	123376516	missense	probably damaging	1.00
R1404:Macf1	UTSW	4	123376516	missense	probably damaging	1.00
R1443:Macf1	UTSW	4	123511007	missense	probably damaging	1.00
R1452:Macf1	UTSW	4	123493998	missense	probably benign
R1465:Macf1	UTSW	4	123493154	missense	probably damaging	0.98
R1465:Macf1	UTSW	4	123493154	missense	probably damaging	0.98
R1483:Macf1	UTSW	4	123510977	missense	probably damaging	1.00
R1509:Macf1	UTSW	4	123684009	missense	possibly damaging	0.92
R1510:Macf1	UTSW	4	123434762	missense	probably null	1.00
R1515:Macf1	UTSW	4	123378480	missense	probably damaging	1.00
R1524:Macf1	UTSW	4	123432530	missense	possibly damaging	0.75
R1528:Macf1	UTSW	4	123476014	missense	probably benign	0.30
R1535:Macf1	UTSW	4	123440693	missense	probably benign	0.05
R1556:Macf1	UTSW	4	123455020	missense	probably damaging	1.00
R1564:Macf1	UTSW	4	123459357	missense	probably benign	0.00
R1586:Macf1	UTSW	4	123509846	missense	probably benign	0.20
R1626:Macf1	UTSW	4	123471534	missense	probably benign
R1629:Macf1	UTSW	4	123508415	nonsense	probably null
R1649:Macf1	UTSW	4	123484053	missense	probably damaging	0.96
R1650:Macf1	UTSW	4	123456600	nonsense	probably null
R1706:Macf1	UTSW	4	123370584	critical splice donor site	probably null
R1713:Macf1	UTSW	4	123378694	missense	probably damaging	1.00
R1716:Macf1	UTSW	4	123401403	missense	probably damaging	1.00
R1744:Macf1	UTSW	4	123475853	missense	probably damaging	1.00
R1752:Macf1	UTSW	4	123483672	missense	possibly damaging	0.92
R1771:Macf1	UTSW	4	123512108	missense	probably damaging	1.00
R1812:Macf1	UTSW	4	123432024	missense	probably damaging	1.00
R1818:Macf1	UTSW	4	123376417	missense	probably damaging	1.00
R1853:Macf1	UTSW	4	123512720	splice site	probably null
R1856:Macf1	UTSW	4	123369848	missense	probably damaging	1.00
R1869:Macf1	UTSW	4	123351128	missense	probably damaging	1.00
R1880:Macf1	UTSW	4	123438591	missense	probably damaging	1.00
R1888:Macf1	UTSW	4	123455042	missense	possibly damaging	0.91
R1888:Macf1	UTSW	4	123474712	missense	probably benign
R1888:Macf1	UTSW	4	123455042	missense	possibly damaging	0.91
R1888:Macf1	UTSW	4	123474712	missense	probably benign
R1902:Macf1	UTSW	4	123471165	missense	probably benign	0.01
R1907:Macf1	UTSW	4	123372399	missense	probably damaging	1.00
R1908:Macf1	UTSW	4	123457841	missense	possibly damaging	0.67
R1932:Macf1	UTSW	4	123452037	missense	probably damaging	1.00
R1944:Macf1	UTSW	4	123370666	missense	probably damaging	1.00
R1945:Macf1	UTSW	4	123490660	nonsense	probably null
R1975:Macf1	UTSW	4	123489212	missense	probably damaging	1.00
R1989:Macf1	UTSW	4	123497726	critical splice donor site	probably null
R1991:Macf1	UTSW	4	123456695	missense	probably damaging	1.00
R1992:Macf1	UTSW	4	123456695	missense	probably damaging	1.00
R2013:Macf1	UTSW	4	123684014	missense	probably damaging	1.00
R2021:Macf1	UTSW	4	123472730	missense	probably damaging	1.00
R2022:Macf1	UTSW	4	123472730	missense	probably damaging	1.00
R2023:Macf1	UTSW	4	123472730	missense	probably damaging	1.00
R2024:Macf1	UTSW	4	123371918	missense	probably damaging	1.00
R2025:Macf1	UTSW	4	123371918	missense	probably damaging	1.00
R2027:Macf1	UTSW	4	123371918	missense	probably damaging	1.00
R2049:Macf1	UTSW	4	123355102	missense	probably damaging	1.00
R2060:Macf1	UTSW	4	123499919	splice site	probably null
R2092:Macf1	UTSW	4	123383178	missense	probably damaging	1.00
R2100:Macf1	UTSW	4	123397906	nonsense	probably null
R2128:Macf1	UTSW	4	123492774	missense	probably benign	0.11
R2129:Macf1	UTSW	4	123368815	splice site	probably benign
R2140:Macf1	UTSW	4	123355102	missense	probably damaging	1.00
R2142:Macf1	UTSW	4	123355102	missense	probably damaging	1.00
R2182:Macf1	UTSW	4	123492671	missense	probably damaging	0.98
R2185:Macf1	UTSW	4	123475556	missense	probably damaging	0.99
R2190:Macf1	UTSW	4	123459212	missense	probably benign	0.11
R2320:Macf1	UTSW	4	123439495	missense	probably benign	0.02
R2382:Macf1	UTSW	4	123374832	missense	probably damaging	1.00
R2429:Macf1	UTSW	4	123432584	missense	probably damaging	0.99
R2432:Macf1	UTSW	4	123683996	missense	probably damaging	1.00
R2484:Macf1	UTSW	4	123473672	missense	probably damaging	1.00
R2842:Macf1	UTSW	4	123376417	missense	probably damaging	1.00
R2912:Macf1	UTSW	4	123475911	missense	probably damaging	1.00
R2913:Macf1	UTSW	4	123475911	missense	probably damaging	1.00
R2914:Macf1	UTSW	4	123475911	missense	probably damaging	1.00
R2938:Macf1	UTSW	4	123432902	missense	probably damaging	0.99
R3082:Macf1	UTSW	4	123361443	splice site	probably null
R3086:Macf1	UTSW	4	123435108	missense	probably benign	0.00
R3408:Macf1	UTSW	4	123381781	missense	probably damaging	1.00
R3499:Macf1	UTSW	4	123527305	nonsense	probably null
R3696:Macf1	UTSW	4	123456362	missense	probably damaging	1.00
R3716:Macf1	UTSW	4	123473502	missense	probably benign	0.01
R3727:Macf1	UTSW	4	123459311	missense	probably damaging	1.00
R3770:Macf1	UTSW	4	123374767	missense	probably damaging	1.00
R3813:Macf1	UTSW	4	123374767	missense	probably damaging	1.00
R3825:Macf1	UTSW	4	123444951	missense	probably benign	0.11
R3893:Macf1	UTSW	4	123486406	missense	probably damaging	1.00
R3896:Macf1	UTSW	4	123471194	missense	possibly damaging	0.55
R3947:Macf1	UTSW	4	123380420	missense	probably damaging	1.00
R4031:Macf1	UTSW	4	123381312	missense	probably damaging	1.00
R4052:Macf1	UTSW	4	123472017	missense	probably benign	0.00
R4077:Macf1	UTSW	4	123472091	missense	probably benign	0.07
R4078:Macf1	UTSW	4	123472091	missense	probably benign	0.07
R4084:Macf1	UTSW	4	123450072	missense	probably damaging	0.98
R4094:Macf1	UTSW	4	123459269	missense	probably benign	0.00
R4154:Macf1	UTSW	4	123471813	missense	probably damaging	1.00
R4190:Macf1	UTSW	4	123473042	missense	possibly damaging	0.95
R4191:Macf1	UTSW	4	123473042	missense	possibly damaging	0.95
R4192:Macf1	UTSW	4	123473042	missense	possibly damaging	0.95
R4232:Macf1	UTSW	4	123432392	missense	probably damaging	1.00
R4299:Macf1	UTSW	4	123399406	missense	probably damaging	1.00
R4326:Macf1	UTSW	4	123382212	missense	probably damaging	1.00
R4327:Macf1	UTSW	4	123382212	missense	probably damaging	1.00
R4355:Macf1	UTSW	4	123475091	missense	possibly damaging	0.79
R4380:Macf1	UTSW	4	123354492	intron	probably benign
R4422:Macf1	UTSW	4	123466046	missense	probably damaging	0.96
R4436:Macf1	UTSW	4	123527342	missense	probably benign	0.03
R4472:Macf1	UTSW	4	123395989	missense	probably damaging	1.00
R4515:Macf1	UTSW	4	123493988	missense	probably damaging	1.00
R4549:Macf1	UTSW	4	123473693	missense	possibly damaging	0.75
R4621:Macf1	UTSW	4	123372348	critical splice donor site	probably null
R4622:Macf1	UTSW	4	123372348	critical splice donor site	probably null
R4623:Macf1	UTSW	4	123372348	critical splice donor site	probably null
R4630:Macf1	UTSW	4	123473639	missense	possibly damaging	0.84
R4647:Macf1	UTSW	4	123473627	missense	probably benign	0.01
R4650:Macf1	UTSW	4	123473619	missense	probably benign	0.00
R4674:Macf1	UTSW	4	123472397	missense	probably benign	0.22
R4751:Macf1	UTSW	4	123471650	missense	probably benign	0.01
R4762:Macf1	UTSW	4	123455444	missense	probably benign	0.00
R4776:Macf1	UTSW	4	123476015	missense	probably benign	0.00
R4777:Macf1	UTSW	4	123376502	missense	probably damaging	1.00
R4860:Macf1	UTSW	4	123486750	missense	probably damaging	1.00
R4860:Macf1	UTSW	4	123486750	missense	probably damaging	1.00
R4865:Macf1	UTSW	4	123433303	missense	probably damaging	1.00
R4867:Macf1	UTSW	4	123472200	missense	probably damaging	0.97
R4884:Macf1	UTSW	4	123455009	missense	probably benign	0.02
R4890:Macf1	UTSW	4	123448238	missense	probably damaging	1.00
R4913:Macf1	UTSW	4	123499889	missense	probably damaging	1.00
R4925:Macf1	UTSW	4	123526652	missense	probably benign
R4948:Macf1	UTSW	4	123497755	missense	probably damaging	1.00
R4958:Macf1	UTSW	4	123475364	missense	probably damaging	0.99
R4986:Macf1	UTSW	4	123391121	missense	probably damaging	1.00
R4999:Macf1	UTSW	4	123494909	missense	probably benign	0.14
R5004:Macf1	UTSW	4	123385475	missense	probably damaging	1.00
R5017:Macf1	UTSW	4	123452113	missense	probably damaging	1.00
R5018:Macf1	UTSW	4	123385599	missense	probably damaging	1.00
R5026:Macf1	UTSW	4	123439494	missense	possibly damaging	0.95
R5037:Macf1	UTSW	4	123455519	missense	probably damaging	0.97
R5039:Macf1	UTSW	4	123511220	missense	probably damaging	1.00
R5041:Macf1	UTSW	4	123397046	splice site	probably null
R5100:Macf1	UTSW	4	123474468	missense	probably benign	0.11
R5110:Macf1	UTSW	4	123368008	missense	probably damaging	0.99
R5122:Macf1	UTSW	4	123452292	missense	probably damaging	1.00
R5187:Macf1	UTSW	4	123472089	missense	probably benign	0.00
R5191:Macf1	UTSW	4	123472962	missense	probably benign	0.00
R5201:Macf1	UTSW	4	123475945	nonsense	probably null
R5236:Macf1	UTSW	4	123397821	missense	probably damaging	1.00
R5248:Macf1	UTSW	4	123401774	nonsense	probably null
R5251:Macf1	UTSW	4	123449967	missense	probably benign	0.20
R5319:Macf1	UTSW	4	123473436	missense	probably damaging	1.00
R5326:Macf1	UTSW	4	123350991	frame shift	probably null
R5327:Macf1	UTSW	4	123350991	frame shift	probably null
R5328:Macf1	UTSW	4	123350991	frame shift	probably null
R5350:Macf1	UTSW	4	123527458	start codon destroyed	probably null	0.02
R5390:Macf1	UTSW	4	123471753	missense	probably damaging	0.98
R5419:Macf1	UTSW	4	123397124	missense	possibly damaging	0.70
R5428:Macf1	UTSW	4	123384868	missense	probably damaging	1.00
R5432:Macf1	UTSW	4	123459336	nonsense	probably null
R5466:Macf1	UTSW	4	123452865	missense	possibly damaging	0.75
R5472:Macf1	UTSW	4	123450061	missense	probably benign
R5564:Macf1	UTSW	4	123526745	missense	possibly damaging	0.92
R5566:Macf1	UTSW	4	123435164	missense	probably damaging	0.98
R5597:Macf1	UTSW	4	123539777	intron	probably benign
R5669:Macf1	UTSW	4	123476225	missense	probably damaging	1.00
R5682:Macf1	UTSW	4	123434759	missense	probably damaging	1.00
R5701:Macf1	UTSW	4	123503225	missense	probably damaging	1.00
R5715:Macf1	UTSW	4	123684014	missense	probably damaging	1.00
R5760:Macf1	UTSW	4	123513884	missense	probably damaging	1.00
R5806:Macf1	UTSW	4	123371887	missense	probably damaging	1.00
R5838:Macf1	UTSW	4	123452154	missense	possibly damaging	0.95
R5839:Macf1	UTSW	4	123381324	missense	probably damaging	1.00
R5850:Macf1	UTSW	4	123507306	missense	probably damaging	1.00
R5875:Macf1	UTSW	4	123432314	missense	possibly damaging	0.78
R5912:Macf1	UTSW	4	123397158	missense	probably damaging	1.00
R5913:Macf1	UTSW	4	123476039	missense	probably damaging	1.00
R5921:Macf1	UTSW	4	123526711	missense	probably benign
R5940:Macf1	UTSW	4	123432881	missense	probably damaging	1.00
R5950:Macf1	UTSW	4	123439436	splice site	probably null
R6005:Macf1	UTSW	4	123474275	missense	possibly damaging	0.82
R6029:Macf1	UTSW	4	123507333	missense	probably damaging	1.00
R6041:Macf1	UTSW	4	123513848	missense	probably damaging	1.00
R6057:Macf1	UTSW	4	123510743	missense	probably damaging	0.98
R6156:Macf1	UTSW	4	123472280	missense	probably benign	0.00
R6186:Macf1	UTSW	4	123484175	missense	probably damaging	1.00
R6197:Macf1	UTSW	4	123452292	missense	probably damaging	1.00
R6262:Macf1	UTSW	4	123473190	missense	possibly damaging	0.79
R6296:Macf1	UTSW	4	123432875	missense	probably damaging	1.00
R6340:Macf1	UTSW	4	123448249	missense	probably benign	0.13
R6369:Macf1	UTSW	4	123410562	missense	possibly damaging	0.90
R6414:Macf1	UTSW	4	123493195	missense	possibly damaging	0.93
R6429:Macf1	UTSW	4	123401594	splice site	probably null
R6501:Macf1	UTSW	4	123469632	splice site	probably null
R6508:Macf1	UTSW	4	123469742	missense	probably damaging	0.96
R6519:Macf1	UTSW	4	123472325	missense	probably benign	0.13
R6535:Macf1	UTSW	4	123471935	missense	possibly damaging	0.82
R6537:Macf1	UTSW	4	123492725	missense	probably damaging	1.00
R6546:Macf1	UTSW	4	123432281	missense	probably benign	0.14
R6583:Macf1	UTSW	4	123470946	splice site	probably null
R6597:Macf1	UTSW	4	123382692	missense	probably damaging	1.00
R6693:Macf1	UTSW	4	123473808	missense	possibly damaging	0.82
R6696:Macf1	UTSW	4	123509803	missense	probably damaging	1.00
R6704:Macf1	UTSW	4	123410762	intron	probably benign
R6716:Macf1	UTSW	4	123508438	missense	probably damaging	1.00
R6789:Macf1	UTSW	4	123372438	missense	probably damaging	1.00
R6807:Macf1	UTSW	4	123374415	missense	probably damaging	1.00
R6825:Macf1	UTSW	4	123383222	splice site	probably null
R6881:Macf1	UTSW	4	123432453	missense	probably damaging	1.00
R6894:Macf1	UTSW	4	123483687	missense	possibly damaging	0.89
R6924:Macf1	UTSW	4	123527352	missense	possibly damaging	0.53
R6962:Macf1	UTSW	4	123440722	missense	probably benign	0.01
R6965:Macf1	UTSW	4	123408745	missense	probably benign	0.38
R6969:Macf1	UTSW	4	123457800	missense	probably benign	0.01
R7032:Macf1	UTSW	4	123472308	missense	probably benign	0.00
R7055:Macf1	UTSW	4	123409196	missense	probably benign	0.01
R7078:Macf1	UTSW	4	123432143	missense	probably damaging	0.99
R7215:Macf1	UTSW	4	123507304	missense	probably damaging	1.00
R7263:Macf1	UTSW	4	123378150	missense	probably damaging	1.00
R7265:Macf1	UTSW	4	123407877	missense	probably benign	0.00
R7278:Macf1	UTSW	4	123440743	missense	possibly damaging	0.87
R7312:Macf1	UTSW	4	123506337	missense	probably damaging	1.00
R7324:Macf1	UTSW	4	123374425	missense	probably benign	0.09
R7334:Macf1	UTSW	4	123399442	missense	probably damaging	1.00
R7342:Macf1	UTSW	4	123382124	missense	probably damaging	1.00
R7409:Macf1	UTSW	4	123504470	missense	probably damaging	1.00
R7436:Macf1	UTSW	4	123456643	missense	probably benign
R7440:Macf1	UTSW	4	123455446	nonsense	probably null
R7462:Macf1	UTSW	4	123492763	missense	probably damaging	1.00
R7471:Macf1	UTSW	4	123472289	missense	probably benign	0.00
R7472:Macf1	UTSW	4	123433067	missense	probably benign	0.16
R7486:Macf1	UTSW	4	123409581	missense	probably benign	0.00
R7492:Macf1	UTSW	4	123475731	missense	possibly damaging	0.83
R7511:Macf1	UTSW	4	123473300	missense	possibly damaging	0.72
R7528:Macf1	UTSW	4	123432059	missense	possibly damaging	0.90
R7547:Macf1	UTSW	4	123441617	missense	probably damaging	1.00
R7592:Macf1	UTSW	4	123410893	intron	probably benign
R7723:Macf1	UTSW	4	123432924	missense	probably benign	0.00
R7731:Macf1	UTSW	4	123444879	missense	probably benign	0.19
R7739:Macf1	UTSW	4	123385598	missense	probably damaging	1.00
R7798:Macf1	UTSW	4	123378100	missense	probably damaging	1.00
R7799:Macf1	UTSW	4	123527113	missense	probably benign	0.00
R7801:Macf1	UTSW	4	123408271	missense	probably damaging	0.97
R7842:Macf1	UTSW	4	123526909	missense	probably benign	0.12
R7849:Macf1	UTSW	4	123407599	missense	probably benign	0.00
R7873:Macf1	UTSW	4	123504551	critical splice acceptor site	probably null
R7933:Macf1	UTSW	4	123409651	missense	probably benign	0.00
R7934:Macf1	UTSW	4	123473934	missense	possibly damaging	0.89
R7947:Macf1	UTSW	4	123401407	missense	probably damaging	0.98
R7988:Macf1	UTSW	4	123506480	missense	probably damaging	1.00
R7992:Macf1	UTSW	4	123395960	missense	probably damaging	1.00
R8013:Macf1	UTSW	4	123526826	missense	probably benign	0.00
R8014:Macf1	UTSW	4	123526826	missense	probably benign	0.00
R8029:Macf1	UTSW	4	123444892	missense	possibly damaging	0.50
R8064:Macf1	UTSW	4	123459374	missense	possibly damaging	0.91
R8085:Macf1	UTSW	4	123410082	missense	possibly damaging	0.46
R8094:Macf1	UTSW	4	123369867	missense	probably damaging	0.99
R8099:Macf1	UTSW	4	123476129	missense	probably benign	0.22
R8147:Macf1	UTSW	4	123491698	missense	probably damaging	1.00
R8151:Macf1	UTSW	4	123397413	missense	possibly damaging	0.91
R8186:Macf1	UTSW	4	123372426	missense	probably damaging	1.00
R8186:Macf1	UTSW	4	123382130	missense	possibly damaging	0.89
R8192:Macf1	UTSW	4	123440597	missense	probably damaging	1.00
R8196:Macf1	UTSW	4	123382704	missense	probably damaging	1.00
R8260:Macf1	UTSW	4	123472070	missense	probably benign
R8305:Macf1	UTSW	4	123395621	intron	probably benign
R8333:Macf1	UTSW	4	123385452	splice site	probably null
R8334:Macf1	UTSW	4	123432108	missense	possibly damaging	0.82
R8344:Macf1	UTSW	4	123384683	missense	probably damaging	1.00
R8344:Macf1	UTSW	4	123526856	missense	probably benign
R8422:Macf1	UTSW	4	123409486	missense	possibly damaging	0.46
R8459:Macf1	UTSW	4	123480314	missense	possibly damaging	0.68
R8466:Macf1	UTSW	4	123455444	missense	probably benign	0.00
R8472:Macf1	UTSW	4	123453002	missense	probably damaging	1.00
R8556:Macf1	UTSW	4	123488343	missense	probably damaging	1.00
RF011:Macf1	UTSW	4	123473855	missense	probably damaging	1.00
X0022:Macf1	UTSW	4	123450042	missense	probably damaging	0.99
X0027:Macf1	UTSW	4	123503269	missense	probably damaging	1.00
X0064:Macf1	UTSW	4	123511874	missense	probably damaging	1.00
Z1177:Macf1	UTSW	4	123471475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACCTCTCACTCCGACAGGA -3'
(R):5'- GTAAATGCTAACACTCACACAGTAT -3'

Sequencing Primer
(F):5'- GACAGGATCGCTCACTGAG -3'
(R):5'- ATTAGTCTTGGCATGTGC -3'

Posted On

2019-11-26