Incidental Mutation 'R7740:Vmn2r12'
ID596484
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7740 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109091749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 316 (V316D)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect probably damaging
Transcript: ENSMUST00000095922
AA Change: V316D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: V316D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109090504 missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109085870 nonsense probably null
R6142:Vmn2r12 UTSW 5 109092897 missense probably benign
R6162:Vmn2r12 UTSW 5 109086564 missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
R7749:Vmn2r12 UTSW 5 109086054 missense probably damaging 0.99
R7861:Vmn2r12 UTSW 5 109087963 missense probably benign 0.00
R7908:Vmn2r12 UTSW 5 109086441 missense probably damaging 1.00
R7944:Vmn2r12 UTSW 5 109087963 missense probably benign 0.00
R7989:Vmn2r12 UTSW 5 109086441 missense probably damaging 1.00
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Z1176:Vmn2r12 UTSW 5 109091437 missense not run
Predicted Primers PCR Primer
(F):5'- GTGCTGTCCATTCCAATGTG -3'
(R):5'- TGCAGTTATATATGACAAGGGCTGAG -3'

Sequencing Primer
(F):5'- CCATTCCAATGTGTTGTTGAATG -3'
(R):5'- TATGACAAGGGCTGAGATATATGAC -3'
Posted On2019-11-26