Incidental Mutation 'R7740:Il21r'
ID596492
Institutional Source Beutler Lab
Gene Symbol Il21r
Ensembl Gene ENSMUSG00000030745
Gene Nameinterleukin 21 receptor
SynonymsNILR
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7740 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125603429-125633570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125632555 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 385 (L385Q)
Ref Sequence ENSEMBL: ENSMUSP00000033000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033000
AA Change: L385Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: L385Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 120 209 3.4e0 SMART
low complexity region 239 250 N/A INTRINSIC
low complexity region 307 312 N/A INTRINSIC
low complexity region 424 450 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206103
Predicted Effect probably benign
Transcript: ENSMUST00000206234
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Il21r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Il21r APN 7 125632525 missense probably damaging 1.00
bellflower UTSW 7 125628043 critical splice acceptor site probably null
R0409:Il21r UTSW 7 125629840 intron probably benign
R0573:Il21r UTSW 7 125625285 missense probably benign 0.06
R0635:Il21r UTSW 7 125632506 missense probably damaging 1.00
R1933:Il21r UTSW 7 125628981 missense possibly damaging 0.92
R1969:Il21r UTSW 7 125628972 missense probably damaging 0.99
R3716:Il21r UTSW 7 125632269 missense probably damaging 0.96
R3968:Il21r UTSW 7 125628043 critical splice acceptor site probably null
R4546:Il21r UTSW 7 125628899 missense probably damaging 1.00
R5086:Il21r UTSW 7 125632855 missense probably damaging 0.99
R5566:Il21r UTSW 7 125625298 missense probably damaging 1.00
R5988:Il21r UTSW 7 125632288 missense probably damaging 0.99
R6234:Il21r UTSW 7 125632585 missense probably damaging 1.00
R6259:Il21r UTSW 7 125630719 missense possibly damaging 0.65
R6896:Il21r UTSW 7 125626956 missense probably damaging 1.00
R7162:Il21r UTSW 7 125632311 missense probably benign 0.00
R7263:Il21r UTSW 7 125632905 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGCCAAGGAGAAGAAGTTCC -3'
(R):5'- TTGCAAATGACAGCCTCAAC -3'

Sequencing Primer
(F):5'- AAGAAGTTCCCGGGGCTG -3'
(R):5'- TCAACCTGTCCAGTAGGCTG -3'
Posted On2019-11-26