Incidental Mutation 'R7740:Greb1'
ID596509
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7740 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 16740121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000161998] [ENSMUST00000162112]
Predicted Effect probably benign
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161998
SMART Domains Protein: ENSMUSP00000124275
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162112
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Herc6 T G 6: 57,659,817 probably null Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Poteg T A 8: 27,462,024 probably null Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc4a2 A G 5: 24,431,668 probably null Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R7937:Greb1 UTSW 12 16716669 missense probably damaging 0.99
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTCCAGATACAGCTG -3'
(R):5'- AACTCTTCTTTGTGGGATACGC -3'

Sequencing Primer
(F):5'- CTCCAGATACAGCTGCGAGAAAATG -3'
(R):5'- CTTTGTGGGATACGCTAAGAGGC -3'
Posted On2019-11-26