Mutagenetix > Incidental Mutations

Incidental Mutation 'R7740:Greb1'

596509

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7740 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

C to A at 16740121 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000161998] [ENSMUST00000162112]

Predicted Effect

probably benign
Transcript: ENSMUST00000048064

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159120

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161998

SMART Domains

Protein: ENSMUSP00000124275
Gene: ENSMUSG00000036523

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162112

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,731,261	V914A	probably damaging	Het
4930522L14Rik	G	A	5: 109,737,504	Q163*	probably null	Het
Anxa6	T	A	11: 55,007,899	T150S	probably damaging	Het
Bpifb6	T	A	2: 153,903,009	L45Q	probably damaging	Het
Brwd1	T	C	16: 96,027,368	D1121G	probably damaging	Het
C1ql3	A	G	2: 13,010,672	I59T	possibly damaging	Het
Ccdc80	A	G	16: 45,104,525	H674R	possibly damaging	Het
Cdhr1	T	G	14: 37,089,380	E258A	probably damaging	Het
Ces2g	T	A	8: 104,966,330	F333L	probably damaging	Het
Chn2	C	T	6: 54,300,171	T445I	probably benign	Het
Cpe	T	C	8: 64,597,528	D382G	possibly damaging	Het
Crb1	T	A	1: 139,237,690	I960L	probably benign	Het
Cyp4a14	A	T	4: 115,493,609	V156D	probably damaging	Het
Ddx23	A	T	15: 98,658,434	M1K	probably null	Het
Dnajc7	T	C	11: 100,591,561	I202V	probably benign	Het
Dsn1	T	A	2: 156,997,716	D255V	possibly damaging	Het
Dvl3	A	T	16: 20,527,250		probably null	Het
Epm2a	A	G	10: 11,390,940	D143G	possibly damaging	Het
Erc1	T	A	6: 119,761,188	M565L	probably benign	Het
Fancm	T	C	12: 65,126,547	C1878R	possibly damaging	Het
Gapvd1	T	C	2: 34,700,822	E946G	probably damaging	Het
Gm9195	C	T	14: 72,440,673	R2352K	possibly damaging	Het
Haus5	G	A	7: 30,663,253	A44V	possibly damaging	Het
Herc4	A	G	10: 63,269,678	Y146C	probably benign	Het
Herc6	T	G	6: 57,659,817		probably null	Het
Hivep2	G	T	10: 14,127,670	G4V	probably damaging	Het
Hsdl2	G	T	4: 59,612,724	G425V	probably damaging	Het
Igkv1-110	C	T	6: 68,270,990	L28F	probably benign	Het
Il21r	T	A	7: 125,632,555	L385Q	possibly damaging	Het
Krtap5-1	ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG	ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG	7: 142,296,596		probably benign	Het
Krtap5-2	C	T	7: 142,174,962	C149Y	unknown	Het
Lingo2	T	A	4: 35,709,248	N244I	probably damaging	Het
Lrrk2	C	T	15: 91,767,324	R1728C	probably damaging	Het
Macf1	A	G	4: 123,684,303		probably benign	Het
Malrd1	G	A	2: 15,614,215	V297I	not run	Het
Mars	T	A	10: 127,300,575	E460D	probably benign	Het
Nr1i3	A	G	1: 171,216,827	I174V	probably benign	Het
Odf2	C	T	2: 29,930,624	T814M	probably damaging	Het
Olfr1302	A	T	2: 111,780,448	I43F	possibly damaging	Het
Olfr1494	T	C	19: 13,749,964	V286A	probably benign	Het
Olfr728	T	C	14: 50,140,346	M98V	probably benign	Het
Pcdhga8	T	C	18: 37,727,417	S509P	probably benign	Het
Pdzd2	A	G	15: 12,374,016	L2011S	probably benign	Het
Pole	T	A	5: 110,331,041	S1930T	probably benign	Het
Poteg	T	A	8: 27,462,024		probably null	Het
Ptprk	T	A	10: 28,496,924	C724S	probably damaging	Het
Rabgap1l	T	C	1: 160,682,103	E468G	probably benign	Het
Rbm12b1	G	T	4: 12,145,954	R642L	probably benign	Het
S1pr4	A	T	10: 81,499,021	Y206*	probably null	Het
Sim2	A	G	16: 94,114,960	I261V	probably benign	Het
Slc22a12	C	A	19: 6,537,169	A448S	probably benign	Het
Slc4a2	A	G	5: 24,431,668		probably null	Het
Slc6a7	T	C	18: 61,000,423	E567G	possibly damaging	Het
St6gal1	T	C	16: 23,321,035		probably benign	Het
Syne3	T	C	12: 104,954,287	K550R	probably benign	Het
Tekt1	T	A	11: 72,359,718	T51S	probably benign	Het
Tm9sf4	T	A	2: 153,208,743	V640E	probably damaging	Het
Tnfsf8	G	T	4: 63,834,446	H127Q	possibly damaging	Het
Tomm20	A	G	8: 126,939,883	L80S	probably damaging	Het
Top2a	T	C	11: 98,993,814	D1526G	probably benign	Het
Trmt1l	T	C	1: 151,440,888	V200A	possibly damaging	Het
Trpa1	A	G	1: 14,912,401	V77A	possibly damaging	Het
Vmn2r12	A	T	5: 109,091,749	V316D	probably damaging	Het
Vmn2r14	A	T	5: 109,220,458	L223M	probably benign	Het
Zfp2	T	C	11: 50,900,778	H146R	probably damaging	Het
Zfp52	T	C	17: 21,560,990	S367P	probably damaging	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCCTCCAGATACAGCTG -3'
(R):5'- AACTCTTCTTTGTGGGATACGC -3'

Sequencing Primer
(F):5'- CTCCAGATACAGCTGCGAGAAAATG -3'
(R):5'- CTTTGTGGGATACGCTAAGAGGC -3'

Posted On

2019-11-26