Incidental Mutation 'R7740:Fancm'
ID596510
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R7740 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65126547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1878 (C1878R)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058889] [ENSMUST00000222540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058889
AA Change: C1878R

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: C1878R

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221175
Predicted Effect probably benign
Transcript: ENSMUST00000222540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Herc6 T G 6: 57,659,817 probably null Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Poteg T A 8: 27,462,024 probably null Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc4a2 A G 5: 24,431,668 probably null Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
R7585:Fancm UTSW 12 65106247 missense possibly damaging 0.62
R7610:Fancm UTSW 12 65105680 missense probably damaging 1.00
R7722:Fancm UTSW 12 65106461 missense probably damaging 1.00
R7867:Fancm UTSW 12 65116466 critical splice donor site probably null
R7867:Fancm UTSW 12 65118399 missense probably benign 0.12
R7882:Fancm UTSW 12 65126794 missense probably benign 0.12
R7950:Fancm UTSW 12 65116466 critical splice donor site probably null
R7950:Fancm UTSW 12 65118399 missense probably benign 0.12
R7965:Fancm UTSW 12 65126794 missense probably benign 0.12
Z1176:Fancm UTSW 12 65094926 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTCAGTGATGAGATGGTAGAATTTC -3'
(R):5'- TGGAAGTGCTTCAAGTTTACTAGTG -3'

Sequencing Primer
(F):5'- GGCATCGGATCCCATTACAGATG -3'
(R):5'- GTTTAGCACTGCTGGGATATGAATAC -3'
Posted On2019-11-26