Incidental Mutation 'R7740:Slc6a7'
ID596525
Institutional Source Beutler Lab
Gene Symbol Slc6a7
Ensembl Gene ENSMUSG00000052026
Gene Namesolute carrier family 6 (neurotransmitter transporter, L-proline), member 7
SynonymsProt
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7740 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location60995381-61014199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61000423 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 567 (E567G)
Ref Sequence ENSEMBL: ENSMUSP00000025520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025520]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025520
AA Change: E567G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025520
Gene: ENSMUSG00000052026
AA Change: E567G

DomainStartEndE-ValueType
Pfam:SNF 37 561 1.2e-231 PFAM
low complexity region 623 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Herc6 T G 6: 57,659,817 probably null Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr1494 T C 19: 13,749,964 V286A probably benign Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Poteg T A 8: 27,462,024 probably null Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc4a2 A G 5: 24,431,668 probably null Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Slc6a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc6a7 APN 18 61001609 missense possibly damaging 0.88
IGL00433:Slc6a7 APN 18 61001291 critical splice donor site probably null
IGL01391:Slc6a7 APN 18 61003310 missense probably damaging 1.00
IGL01476:Slc6a7 APN 18 61005773 missense probably damaging 1.00
IGL02705:Slc6a7 APN 18 61009428 missense probably damaging 1.00
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0106:Slc6a7 UTSW 18 61002223 missense probably benign 0.04
R0147:Slc6a7 UTSW 18 61002111 splice site probably benign
R0267:Slc6a7 UTSW 18 60996711 missense probably benign 0.00
R1349:Slc6a7 UTSW 18 61000543 missense probably benign 0.03
R1498:Slc6a7 UTSW 18 60996692 missense probably benign 0.02
R1874:Slc6a7 UTSW 18 61001398 splice site probably benign
R2005:Slc6a7 UTSW 18 61001641 missense possibly damaging 0.68
R3051:Slc6a7 UTSW 18 61009517 missense probably damaging 0.96
R3970:Slc6a7 UTSW 18 61003345 missense possibly damaging 0.94
R4573:Slc6a7 UTSW 18 61002181 missense probably benign 0.20
R4835:Slc6a7 UTSW 18 61002205 missense probably benign 0.04
R4942:Slc6a7 UTSW 18 61004517 missense probably damaging 1.00
R5112:Slc6a7 UTSW 18 61007376 missense probably null 0.04
R5426:Slc6a7 UTSW 18 61003236 splice site probably null
R6168:Slc6a7 UTSW 18 61001662 missense probably benign 0.18
R6312:Slc6a7 UTSW 18 61002385 missense probably benign 0.12
R6489:Slc6a7 UTSW 18 61007543 missense probably damaging 1.00
R7131:Slc6a7 UTSW 18 61002202 missense probably damaging 1.00
R7460:Slc6a7 UTSW 18 61001602 missense probably benign 0.02
R7556:Slc6a7 UTSW 18 61007442 nonsense probably null
R7793:Slc6a7 UTSW 18 61005779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTCCCAAGTGAATCTAGAG -3'
(R):5'- AAGGACCAGTGATGCTCGAG -3'

Sequencing Primer
(F):5'- GACCATGAGTCTCTTGCAGGGTAC -3'
(R):5'- AGTGATGCTCGAGTCTCCAC -3'
Posted On2019-11-26