Incidental Mutation 'R7740:Olfr1494'
ID596527
Institutional Source Beutler Lab
Gene Symbol Olfr1494
Ensembl Gene ENSMUSG00000050865
Gene Nameolfactory receptor 1494
SynonymsMOR266-1, GA_x6K02T2RE5P-4082427-4083374
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7740 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13739728-13750479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13749964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 286 (V286A)
Ref Sequence ENSEMBL: ENSMUSP00000146563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051768] [ENSMUST00000207836]
Predicted Effect probably benign
Transcript: ENSMUST00000051768
AA Change: V286A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000056291
Gene: ENSMUSG00000050865
AA Change: V286A

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
Pfam:7tm_4 35 313 3.2e-53 PFAM
Pfam:7tm_1 45 295 7.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207836
AA Change: V286A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,731,261 V914A probably damaging Het
4930522L14Rik G A 5: 109,737,504 Q163* probably null Het
Anxa6 T A 11: 55,007,899 T150S probably damaging Het
Bpifb6 T A 2: 153,903,009 L45Q probably damaging Het
Brwd1 T C 16: 96,027,368 D1121G probably damaging Het
C1ql3 A G 2: 13,010,672 I59T possibly damaging Het
Ccdc80 A G 16: 45,104,525 H674R possibly damaging Het
Cdhr1 T G 14: 37,089,380 E258A probably damaging Het
Ces2g T A 8: 104,966,330 F333L probably damaging Het
Chn2 C T 6: 54,300,171 T445I probably benign Het
Cpe T C 8: 64,597,528 D382G possibly damaging Het
Crb1 T A 1: 139,237,690 I960L probably benign Het
Cyp4a14 A T 4: 115,493,609 V156D probably damaging Het
Ddx23 A T 15: 98,658,434 M1K probably null Het
Dnajc7 T C 11: 100,591,561 I202V probably benign Het
Dsn1 T A 2: 156,997,716 D255V possibly damaging Het
Dvl3 A T 16: 20,527,250 probably null Het
Epm2a A G 10: 11,390,940 D143G possibly damaging Het
Erc1 T A 6: 119,761,188 M565L probably benign Het
Fancm T C 12: 65,126,547 C1878R possibly damaging Het
Gapvd1 T C 2: 34,700,822 E946G probably damaging Het
Gm9195 C T 14: 72,440,673 R2352K possibly damaging Het
Greb1 C A 12: 16,740,121 probably benign Het
Haus5 G A 7: 30,663,253 A44V possibly damaging Het
Herc4 A G 10: 63,269,678 Y146C probably benign Het
Herc6 T G 6: 57,659,817 probably null Het
Hivep2 G T 10: 14,127,670 G4V probably damaging Het
Hsdl2 G T 4: 59,612,724 G425V probably damaging Het
Igkv1-110 C T 6: 68,270,990 L28F probably benign Het
Il21r T A 7: 125,632,555 L385Q possibly damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Krtap5-2 C T 7: 142,174,962 C149Y unknown Het
Lingo2 T A 4: 35,709,248 N244I probably damaging Het
Lrrk2 C T 15: 91,767,324 R1728C probably damaging Het
Macf1 A G 4: 123,684,303 probably benign Het
Malrd1 G A 2: 15,614,215 V297I not run Het
Mars T A 10: 127,300,575 E460D probably benign Het
Nr1i3 A G 1: 171,216,827 I174V probably benign Het
Odf2 C T 2: 29,930,624 T814M probably damaging Het
Olfr1302 A T 2: 111,780,448 I43F possibly damaging Het
Olfr728 T C 14: 50,140,346 M98V probably benign Het
Pcdhga8 T C 18: 37,727,417 S509P probably benign Het
Pdzd2 A G 15: 12,374,016 L2011S probably benign Het
Pole T A 5: 110,331,041 S1930T probably benign Het
Poteg T A 8: 27,462,024 probably null Het
Ptprk T A 10: 28,496,924 C724S probably damaging Het
Rabgap1l T C 1: 160,682,103 E468G probably benign Het
Rbm12b1 G T 4: 12,145,954 R642L probably benign Het
S1pr4 A T 10: 81,499,021 Y206* probably null Het
Sim2 A G 16: 94,114,960 I261V probably benign Het
Slc22a12 C A 19: 6,537,169 A448S probably benign Het
Slc4a2 A G 5: 24,431,668 probably null Het
Slc6a7 T C 18: 61,000,423 E567G possibly damaging Het
St6gal1 T C 16: 23,321,035 probably benign Het
Syne3 T C 12: 104,954,287 K550R probably benign Het
Tekt1 T A 11: 72,359,718 T51S probably benign Het
Tm9sf4 T A 2: 153,208,743 V640E probably damaging Het
Tnfsf8 G T 4: 63,834,446 H127Q possibly damaging Het
Tomm20 A G 8: 126,939,883 L80S probably damaging Het
Top2a T C 11: 98,993,814 D1526G probably benign Het
Trmt1l T C 1: 151,440,888 V200A possibly damaging Het
Trpa1 A G 1: 14,912,401 V77A possibly damaging Het
Vmn2r12 A T 5: 109,091,749 V316D probably damaging Het
Vmn2r14 A T 5: 109,220,458 L223M probably benign Het
Zfp2 T C 11: 50,900,778 H146R probably damaging Het
Zfp52 T C 17: 21,560,990 S367P probably damaging Het
Other mutations in Olfr1494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1494 APN 19 13749801 missense probably benign 0.04
IGL02335:Olfr1494 APN 19 13749934 missense probably benign 0.01
IGL02388:Olfr1494 APN 19 13749630 missense possibly damaging 0.91
IGL03231:Olfr1494 APN 19 13749385 missense probably benign 0.35
R0133:Olfr1494 UTSW 19 13749988 missense probably damaging 1.00
R0142:Olfr1494 UTSW 19 13749255 missense probably benign 0.00
R0561:Olfr1494 UTSW 19 13749298 missense probably damaging 1.00
R0783:Olfr1494 UTSW 19 13749676 missense probably damaging 0.99
R1826:Olfr1494 UTSW 19 13749347 missense probably benign 0.05
R1967:Olfr1494 UTSW 19 13750053 makesense probably null
R3706:Olfr1494 UTSW 19 13749112 missense probably benign 0.42
R5417:Olfr1494 UTSW 19 13749853 missense probably benign 0.18
R6508:Olfr1494 UTSW 19 13749354 missense probably damaging 1.00
R7126:Olfr1494 UTSW 19 13749523 missense possibly damaging 0.90
R7262:Olfr1494 UTSW 19 13749171 missense probably benign 0.02
R7395:Olfr1494 UTSW 19 13749138 missense probably damaging 0.98
R7744:Olfr1494 UTSW 19 13750055 makesense probably null
R7864:Olfr1494 UTSW 19 13749346 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAATTCTTCGCATGCGCTC -3'
(R):5'- GCTCCCATATTGGAAGCTATATTC -3'

Sequencing Primer
(F):5'- TCTGCAGAGGGTCGCCAG -3'
(R):5'- GAGTTCTTCAGTGCACCT -3'
Posted On2019-11-26