Incidental Mutation 'R7741:Pou2f1'
ID596528
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165875875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 749 (S749P)
Ref Sequence ENSEMBL: ENSMUSP00000124738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000161971] [ENSMUST00000178336] [ENSMUST00000184643] [ENSMUST00000187313]
Predicted Effect probably damaging
Transcript: ENSMUST00000027850
AA Change: S662P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: S662P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069609
AA Change: S714P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: S714P

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111426
AA Change: S714P
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: S714P

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111427
AA Change: S738P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: S738P

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111429
AA Change: S702P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: S702P

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159212
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160260
AA Change: S749P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: S749P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160908
AA Change: S725P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: S725P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161971
SMART Domains Protein: ENSMUSP00000124297
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178336
SMART Domains Protein: ENSMUSP00000136456
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184643
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184799
Predicted Effect probably benign
Transcript: ENSMUST00000187313
SMART Domains Protein: ENSMUSP00000140926
Gene: ENSMUSG00000005763

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 2.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194366
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R4838:Pou2f1 UTSW 1 165916923 missense probably null 1.00
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R5951:Pou2f1 UTSW 1 165883056 unclassified probably benign
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165915115 missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
R8011:Pou2f1 UTSW 1 165894903 critical splice donor site probably null
RF012:Pou2f1 UTSW 1 165913231 missense unknown
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGTAGTGAGGAAAGCC -3'
(R):5'- GGCACACTCTGCTACTGAGTAG -3'

Sequencing Primer
(F):5'- CTGTGGCAACCCAGCTCTG -3'
(R):5'- CTGCTACTGAGTAGGAGTTAGC -3'
Posted On2019-11-26