Incidental Mutation 'R7741:Capn2'
ID596529
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 182479723 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 517 (E517*)
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect probably null
Transcript: ENSMUST00000068505
AA Change: E517*
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509
AA Change: E517*

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2174:Capn2 UTSW 1 182479725 missense probably benign 0.22
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2861:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R5696:Capn2 UTSW 1 182478600 missense possibly damaging 0.79
R6777:Capn2 UTSW 1 182470177 critical splice donor site probably null
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
R7995:Capn2 UTSW 1 182478546 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTCGGGCTTTAATGAACAAGAG -3'
(R):5'- CTTGCTCTATTCCACACGGG -3'

Sequencing Primer
(F):5'- CTTTAATGAACAAGAGACTGGCTG -3'
(R):5'- AAAAAGTATCTCTGCCCTGGCTACTG -3'
Posted On2019-11-26