Incidental Mutation 'R7741:Cyp4a14'
ID 596536
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 045797-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7741 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 115347156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably null
Transcript: ENSMUST00000030487
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,290,551 (GRCm39) P118S probably damaging Het
Adgrl1 T A 8: 84,656,343 (GRCm39) D215E probably damaging Het
Afap1l2 T C 19: 56,902,914 (GRCm39) D755G probably damaging Het
Akr1c18 T A 13: 4,194,332 (GRCm39) D109V possibly damaging Het
Brdt G A 5: 107,506,752 (GRCm39) R445H probably benign Het
Capn2 C A 1: 182,307,288 (GRCm39) E517* probably null Het
Celsr1 A T 15: 85,863,303 (GRCm39) V1243E possibly damaging Het
Cenpe C G 3: 134,953,096 (GRCm39) probably null Het
Cep135 A G 5: 76,778,817 (GRCm39) E748G probably damaging Het
Cfap119 C A 7: 127,187,159 (GRCm39) V35L probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Col6a1 C A 10: 76,545,743 (GRCm39) A910S unknown Het
Dot1l C T 10: 80,619,378 (GRCm39) R412W probably damaging Het
Dyrk2 T C 10: 118,695,594 (GRCm39) T555A probably benign Het
Foxn3 T C 12: 99,162,587 (GRCm39) N438S probably damaging Het
Gdpd5 T C 7: 99,103,001 (GRCm39) F320S probably damaging Het
Grn A G 11: 102,326,560 (GRCm39) H413R probably damaging Het
Gstm7 A T 3: 107,838,963 (GRCm39) M3K possibly damaging Het
Il17rd A G 14: 26,822,293 (GRCm39) E673G probably damaging Het
Klhl29 T C 12: 5,187,500 (GRCm39) D288G possibly damaging Het
Klk1b11 G A 7: 43,426,421 (GRCm39) A79T probably benign Het
Kmt2a A G 9: 44,719,359 (GRCm39) V3914A unknown Het
Map2k2 T C 10: 80,956,877 (GRCm39) V307A probably benign Het
Mst1r G T 9: 107,784,319 (GRCm39) probably benign Het
Nr3c2 A G 8: 77,937,275 (GRCm39) E834G probably damaging Het
Oga A T 19: 45,764,501 (GRCm39) L213H probably damaging Het
Ogfod3 T G 11: 121,074,362 (GRCm39) probably null Het
Or5b102 A T 19: 13,041,423 (GRCm39) Y216F probably damaging Het
Or8d2 T C 9: 38,759,614 (GRCm39) L68P probably damaging Het
Plscr4 A T 9: 92,364,693 (GRCm39) probably null Het
Pou2f1 A G 1: 165,703,444 (GRCm39) S749P probably damaging Het
Ppp4r3b T G 11: 29,155,701 (GRCm39) L556V possibly damaging Het
Psd4 T G 2: 24,291,108 (GRCm39) probably null Het
Rbbp4 T C 4: 129,228,356 (GRCm39) D33G probably damaging Het
Rif1 T A 2: 51,975,153 (GRCm39) M354K probably damaging Het
Rmi1 A G 13: 58,557,067 (GRCm39) K439E probably benign Het
Scgb2b7 A G 7: 31,404,454 (GRCm39) probably null Het
Sdc1 A G 12: 8,841,370 (GRCm39) D237G probably benign Het
Sel1l3 T C 5: 53,357,593 (GRCm39) Y133C probably damaging Het
Snx31 A G 15: 36,523,587 (GRCm39) probably null Het
Snx7 A G 3: 117,632,488 (GRCm39) F201S probably damaging Het
Tas2r131 C T 6: 132,934,438 (GRCm39) V124I possibly damaging Het
Tbx20 A T 9: 24,651,581 (GRCm39) probably null Het
Topbp1 A T 9: 103,197,756 (GRCm39) N445I probably damaging Het
Tpx2 T A 2: 152,709,263 (GRCm39) I31K possibly damaging Het
Trpv3 T A 11: 73,179,088 (GRCm39) V499E probably damaging Het
Tshr G A 12: 91,500,743 (GRCm39) W258* probably null Het
Usp32 G T 11: 84,878,107 (GRCm39) D1543E probably damaging Het
Usp39 A G 6: 72,315,521 (GRCm39) probably benign Het
Vac14 T C 8: 111,361,020 (GRCm39) S197P probably damaging Het
Vars2 A G 17: 35,971,835 (GRCm39) S497P probably damaging Het
Zfp462 C A 4: 55,008,637 (GRCm39) P201Q probably benign Het
Zkscan5 A G 5: 145,157,847 (GRCm39) Q783R possibly damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGATCCTCCTGAGAATGGCAG -3'
(R):5'- GCTGTCTGTTATCACCAGGC -3'

Sequencing Primer
(F):5'- TCCTCCTGAGAATGGCAGATAAGC -3'
(R):5'- GGACCATTAGCTCTACATGATGACTC -3'
Posted On 2019-11-26