Mutagenetix > Incidental Mutation

Incidental Mutation 'R7741:Brdt'

596541

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

045797-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7741 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107358886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 445 (R445H)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: R445H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: R445H

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	C	T	10: 76,454,717	P118S	probably damaging	Het
Adgrl1	T	A	8: 83,929,714	D215E	probably damaging	Het
Afap1l2	T	C	19: 56,914,482	D755G	probably damaging	Het
Akr1c18	T	A	13: 4,144,333	D109V	possibly damaging	Het
Capn2	C	A	1: 182,479,723	E517*	probably null	Het
Ccdc189	C	A	7: 127,587,987	V35L	probably benign	Het
Celsr1	A	T	15: 85,979,102	V1243E	possibly damaging	Het
Cenpe	C	G	3: 135,247,335		probably null	Het
Cep135	A	G	5: 76,630,970	E748G	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Col6a1	C	A	10: 76,709,909	A910S	unknown	Het
Cyp4a14	T	A	4: 115,489,959		probably null	Het
Dot1l	C	T	10: 80,783,544	R412W	probably damaging	Het
Dyrk2	T	C	10: 118,859,689	T555A	probably benign	Het
Foxn3	T	C	12: 99,196,328	N438S	probably damaging	Het
Gdpd5	T	C	7: 99,453,794	F320S	probably damaging	Het
Grn	A	G	11: 102,435,734	H413R	probably damaging	Het
Gstm7	A	T	3: 107,931,647	M3K	possibly damaging	Het
Il17rd	A	G	14: 27,100,336	E673G	probably damaging	Het
Klhl29	T	C	12: 5,137,500	D288G	possibly damaging	Het
Klk11	G	A	7: 43,776,997	A79T	probably benign	Het
Kmt2a	A	G	9: 44,808,062	V3914A	unknown	Het
Map2k2	T	C	10: 81,121,043	V307A	probably benign	Het
Mgea5	A	T	19: 45,776,062	L213H	probably damaging	Het
Mst1r	G	T	9: 107,907,120		probably benign	Het
Nr3c2	A	G	8: 77,210,646	E834G	probably damaging	Het
Ogfod3	T	G	11: 121,183,536		probably null	Het
Olfr1454	A	T	19: 13,064,059	Y216F	probably damaging	Het
Olfr924	T	C	9: 38,848,318	L68P	probably damaging	Het
Plscr4	A	T	9: 92,482,640		probably null	Het
Pou2f1	A	G	1: 165,875,875	S749P	probably damaging	Het
Ppp4r3b	T	G	11: 29,205,701	L556V	possibly damaging	Het
Psd4	T	G	2: 24,401,096		probably null	Het
Rbbp4	T	C	4: 129,334,563	D33G	probably damaging	Het
Rif1	T	A	2: 52,085,141	M354K	probably damaging	Het
Rmi1	A	G	13: 58,409,253	K439E	probably benign	Het
Scgb2b7	A	G	7: 31,705,029		probably null	Het
Sdc1	A	G	12: 8,791,370	D237G	probably benign	Het
Sel1l3	T	C	5: 53,200,251	Y133C	probably damaging	Het
Snx31	A	G	15: 36,523,441		probably null	Het
Snx7	A	G	3: 117,838,839	F201S	probably damaging	Het
Tas2r131	C	T	6: 132,957,475	V124I	possibly damaging	Het
Tbx20	A	T	9: 24,740,285		probably null	Het
Topbp1	A	T	9: 103,320,557	N445I	probably damaging	Het
Tpx2	T	A	2: 152,867,343	I31K	possibly damaging	Het
Trpv3	T	A	11: 73,288,262	V499E	probably damaging	Het
Tshr	G	A	12: 91,533,969	W258*	probably null	Het
Usp32	G	T	11: 84,987,281	D1543E	probably damaging	Het
Usp39	A	G	6: 72,338,538		probably benign	Het
Vac14	T	C	8: 110,634,388	S197P	probably damaging	Het
Vars2	A	G	17: 35,660,943	S497P	probably damaging	Het
Zfp462	C	A	4: 55,008,637	P201Q	probably benign	Het
Zkscan5	A	G	5: 145,221,037	Q783R	possibly damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- ATACTGAGAAATGTTGGGCTGTAG -3'
(R):5'- TGTGTGGTCCTTCACTGAGC -3'

Sequencing Primer
(F):5'- TTCCAAAATGAAGCAAAATCCTGAAG -3'
(R):5'- ACTGAGCCTGCCTCCTG -3'

Posted On

2019-11-26