Incidental Mutation 'R7741:Nr3c2'
ID596548
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77210646 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 834 (E834G)
Ref Sequence ENSEMBL: ENSMUSP00000105538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000148106]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034031
AA Change: E838G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: E838G

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109911
AA Change: E721G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: E721G

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109912
AA Change: E834G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: E834G

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109913
AA Change: E834G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: E834G

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148106
AA Change: R673G

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: R673G

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TTCTCACAGGGAGTTCGTGG -3'
(R):5'- TCTCATGCAGGGAAGATGATCTG -3'

Sequencing Primer
(F):5'- CGTGGGGCTTTAGAAACCATTGAC -3'
(R):5'- TCTGACAATGTAGAAAGAGTGCC -3'
Posted On2019-11-26