Incidental Mutation 'R7741:Plscr4'
ID596553
Institutional Source Beutler Lab
Gene Symbol Plscr4
Ensembl Gene ENSMUSG00000032377
Gene Namephospholipid scramblase 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7741 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location92457373-92492456 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 92482640 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034941]
Predicted Effect probably null
Transcript: ENSMUST00000034941
SMART Domains Protein: ENSMUSP00000034941
Gene: ENSMUSG00000032377

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Pfam:Scramblase 96 318 7.5e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Plscr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Plscr4 APN 9 92484945 missense probably null 1.00
IGL02506:Plscr4 APN 9 92489991 missense possibly damaging 0.67
R0331:Plscr4 UTSW 9 92482642 missense probably damaging 1.00
R0360:Plscr4 UTSW 9 92488761 splice site probably benign
R0838:Plscr4 UTSW 9 92471760 splice site probably benign
R0898:Plscr4 UTSW 9 92484753 missense probably damaging 0.98
R1845:Plscr4 UTSW 9 92490046 missense probably damaging 1.00
R1895:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R1946:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R2127:Plscr4 UTSW 9 92488630 missense possibly damaging 0.82
R3427:Plscr4 UTSW 9 92488744 missense probably damaging 0.99
R4670:Plscr4 UTSW 9 92482867 critical splice donor site probably null
R4764:Plscr4 UTSW 9 92484780 missense probably damaging 0.99
R4958:Plscr4 UTSW 9 92484761 missense possibly damaging 0.95
R5126:Plscr4 UTSW 9 92488741 missense probably damaging 1.00
R5424:Plscr4 UTSW 9 92490022 missense possibly damaging 0.67
R6250:Plscr4 UTSW 9 92484828 missense possibly damaging 0.79
R6476:Plscr4 UTSW 9 92490766 missense probably benign 0.01
R6775:Plscr4 UTSW 9 92482805 missense probably benign
R6810:Plscr4 UTSW 9 92483836 missense probably damaging 0.99
R6982:Plscr4 UTSW 9 92482743 missense probably benign 0.00
R7127:Plscr4 UTSW 9 92490778 nonsense probably null
R7190:Plscr4 UTSW 9 92488641 missense probably benign 0.11
R7818:Plscr4 UTSW 9 92490790 nonsense probably null
R7819:Plscr4 UTSW 9 92490790 nonsense probably null
R7837:Plscr4 UTSW 9 92484923 missense probably damaging 1.00
R7920:Plscr4 UTSW 9 92484923 missense probably damaging 1.00
R8004:Plscr4 UTSW 9 92490790 nonsense probably null
R8005:Plscr4 UTSW 9 92490790 nonsense probably null
R8008:Plscr4 UTSW 9 92490790 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTATATCTGTGAAATGGGCACTC -3'
(R):5'- GCCCTGCCATCCACATTATG -3'

Sequencing Primer
(F):5'- CTGTGAAATGGGCACTCTGACATC -3'
(R):5'- CACATTATGGGAGCAGGCTGATTC -3'
Posted On2019-11-26