Incidental Mutation 'R7741:Col6a1'
ID596557
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R7741 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76709909 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 910 (A910S)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: A910S
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: A910S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cenpe C G 3: 135,247,335 probably null Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Tbx20 A T 9: 24,740,285 probably null Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Usp39 A G 6: 72,338,538 probably benign Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7774:Col6a1 UTSW 10 76709876 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R7917:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTCTTGCCAGTGACAAG -3'
(R):5'- TGAGCGATTCCTGTCAGCAG -3'

Sequencing Primer
(F):5'- ATGTGGGGCTCGTTCACC -3'
(R):5'- AGGCAGGGCGGATCCTTC -3'
Posted On2019-11-26