Incidental Mutation 'R7741:Ppp4r3b'
ID596561
Institutional Source Beutler Lab
Gene Symbol Ppp4r3b
Ensembl Gene ENSMUSG00000020463
Gene Nameprotein phosphatase 4 regulatory subunit 3B
SynonymsSmek2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location29172890-29220797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29205701 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 556 (L556V)
Ref Sequence ENSEMBL: ENSMUSP00000020755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020755] [ENSMUST00000102856] [ENSMUST00000127621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020755
AA Change: L556V

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020755
Gene: ENSMUSG00000020463
AA Change: L556V

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-24 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 168 359 3.6e-84 PFAM
low complexity region 511 519 N/A INTRINSIC
low complexity region 800 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102856
AA Change: L556V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099920
Gene: ENSMUSG00000020463
AA Change: L556V

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-25 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 166 359 3.8e-87 PFAM
low complexity region 511 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127621
AA Change: L135V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117918
Gene: ENSMUSG00000020463
AA Change: L135V

DomainStartEndE-ValueType
low complexity region 90 98 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cenpe C G 3: 135,247,335 probably null Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Tbx20 A T 9: 24,740,285 probably null Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Usp39 A G 6: 72,338,538 probably benign Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Ppp4r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ppp4r3b APN 11 29211782 missense possibly damaging 0.64
IGL00593:Ppp4r3b APN 11 29197205 missense possibly damaging 0.88
IGL01109:Ppp4r3b APN 11 29188288 missense probably damaging 0.97
IGL01311:Ppp4r3b APN 11 29194591 missense probably benign
IGL01397:Ppp4r3b APN 11 29213594 missense probably benign 0.05
IGL01546:Ppp4r3b APN 11 29209488 unclassified probably null
IGL02588:Ppp4r3b APN 11 29198853 nonsense probably null
IGL02713:Ppp4r3b APN 11 29188445 missense probably damaging 0.98
IGL02717:Ppp4r3b APN 11 29173315 missense probably benign 0.01
PIT1430001:Ppp4r3b UTSW 11 29209434 missense probably benign 0.04
PIT4677001:Ppp4r3b UTSW 11 29187978 missense probably benign
R0766:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1170:Ppp4r3b UTSW 11 29209426 missense probably damaging 0.99
R1312:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1511:Ppp4r3b UTSW 11 29182460 missense probably damaging 1.00
R1692:Ppp4r3b UTSW 11 29188123 missense probably benign 0.02
R1699:Ppp4r3b UTSW 11 29213765 missense possibly damaging 0.52
R2303:Ppp4r3b UTSW 11 29200741 missense possibly damaging 0.79
R2339:Ppp4r3b UTSW 11 29200725 missense possibly damaging 0.65
R4378:Ppp4r3b UTSW 11 29209450 missense possibly damaging 0.72
R4940:Ppp4r3b UTSW 11 29211740 missense probably benign
R5256:Ppp4r3b UTSW 11 29188293 missense probably benign 0.22
R5266:Ppp4r3b UTSW 11 29173309 missense possibly damaging 0.63
R5286:Ppp4r3b UTSW 11 29211667 missense probably benign
R5354:Ppp4r3b UTSW 11 29211646 missense probably benign 0.26
R5877:Ppp4r3b UTSW 11 29209356 missense probably damaging 1.00
R6364:Ppp4r3b UTSW 11 29188035 missense probably benign 0.00
R6539:Ppp4r3b UTSW 11 29218503 missense probably benign 0.00
R6773:Ppp4r3b UTSW 11 29205639 missense probably benign 0.02
R6931:Ppp4r3b UTSW 11 29211786 missense possibly damaging 0.88
R7051:Ppp4r3b UTSW 11 29182507 missense probably damaging 1.00
R7176:Ppp4r3b UTSW 11 29198904 missense probably damaging 1.00
R7569:Ppp4r3b UTSW 11 29188540 missense possibly damaging 0.91
R7746:Ppp4r3b UTSW 11 29173352 missense probably benign 0.00
R7810:Ppp4r3b UTSW 11 29188086 missense probably benign 0.02
R8129:Ppp4r3b UTSW 11 29209364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTTTGCCCTAAGATGCAGG -3'
(R):5'- GAATCCACTGCTTCTACTTCACATG -3'

Sequencing Primer
(F):5'- GTGTGGAACATCACACATAC -3'
(R):5'- ACTGCTTCTACTTCACATGCTCTTG -3'
Posted On2019-11-26