Incidental Mutation 'R7741:Usp32'
ID596563
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84987281 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1543 (D1543E)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: D1543E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: D1543E

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173156
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cenpe C G 3: 135,247,335 probably null Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mgea5 A T 19: 45,776,062 L213H probably damaging Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Tbx20 A T 9: 24,740,285 probably null Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp39 A G 6: 72,338,538 probably benign Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGATGACAGGACATGACC -3'
(R):5'- CTAGGTGGTCATCTTGCTTAGATC -3'

Sequencing Primer
(F):5'- GATGACAGGACATGACCAACTC -3'
(R):5'- AGATCTTAGCACTGTGCCTTG -3'
Posted On2019-11-26