Incidental Mutation 'R0067:Unc79'
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
MMRRC Submission 038358-MU
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0067 (G1)
Quality Score220
Status Validated
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103059518 bp
Amino Acid Change Glutamic Acid to Glycine at position 388 (E388G)
Ref Sequence ENSEMBL: ENSMUSP00000136332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178001] [ENSMUST00000178076] [ENSMUST00000179002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085079
AA Change: E264G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: E264G

Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101099
AA Change: E441G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: E441G

Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178001
SMART Domains Protein: ENSMUSP00000137132
Gene: ENSMUSG00000021198

Pfam:UNC-79 1 80 1.2e-30 PFAM
Pfam:UNC-79 78 188 2.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178076
AA Change: E245G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: E245G

Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178846
Predicted Effect probably damaging
Transcript: ENSMUST00000179002
AA Change: E388G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: E388G

Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Pbk G A 14: 65,815,226 V173I possibly damaging Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Scamp1 T C 13: 94,204,150 Y237C probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Skiv2l2 C T 13: 112,886,862 V727I probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Ticrr A T 7: 79,677,410 D622V probably damaging Het
Tie1 A G 4: 118,476,280 probably benign Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1796:Unc79 UTSW 12 103142746 missense probably damaging 0.99
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4898:Unc79 UTSW 12 103161820 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5044:Unc79 UTSW 12 103112703 missense probably benign 0.32
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103059500 missense probably damaging 1.00
R7124:Unc79 UTSW 12 103061393 missense probably damaging 0.99
R7144:Unc79 UTSW 12 103142626 missense probably benign 0.06
R7197:Unc79 UTSW 12 103112506 missense probably benign
R7209:Unc79 UTSW 12 103125624 missense probably benign
R7232:Unc79 UTSW 12 103134475 missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103063190 missense probably damaging 1.00
R7354:Unc79 UTSW 12 103142702 missense possibly damaging 0.79
R7384:Unc79 UTSW 12 103171578 missense probably benign 0.11
R7400:Unc79 UTSW 12 103104630 missense probably damaging 1.00
R7417:Unc79 UTSW 12 103088758 missense possibly damaging 0.85
R7470:Unc79 UTSW 12 103094976 missense probably damaging 1.00
R7842:Unc79 UTSW 12 103092054 missense probably damaging 1.00
R7925:Unc79 UTSW 12 103092054 missense probably damaging 1.00
R7989:Unc79 UTSW 12 103063089 intron probably null
R8037:Unc79 UTSW 12 103049919 missense probably damaging 1.00
R8041:Unc79 UTSW 12 103088467 missense probably benign 0.06
RF010:Unc79 UTSW 12 103112787 missense probably benign 0.17
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Z1176:Unc79 UTSW 12 103088678 missense probably damaging 1.00
Z1176:Unc79 UTSW 12 103142053 missense probably benign 0.03
Z1177:Unc79 UTSW 12 103165689 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cacttgtgtctcccaagtacc -3'
Posted On2013-07-11