Incidental Mutation 'R7741:Rmi1'
ID 596571
Institutional Source Beutler Lab
Gene Symbol Rmi1
Ensembl Gene ENSMUSG00000035367
Gene Name RecQ mediated genome instability 1
Synonyms 4932432N11Rik
MMRRC Submission 045797-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R7741 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 58550062-58558962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58557067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 439 (K439E)
Ref Sequence ENSEMBL: ENSMUSP00000041035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042450] [ENSMUST00000224479] [ENSMUST00000225815] [ENSMUST00000225828]
AlphaFold Q9D4G9
Predicted Effect probably benign
Transcript: ENSMUST00000042450
AA Change: K439E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041035
Gene: ENSMUSG00000035367
AA Change: K439E

DomainStartEndE-ValueType
DUF1767 11 104 1.62e-34 SMART
low complexity region 243 259 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:RMI1_C 479 614 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224479
AA Change: K439E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225815
AA Change: K439E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225828
AA Change: K439E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RMI1 is a component of protein complexes that limit DNA crossover formation via the dissolution of double Holliday junctions (Raynard et al., 2006 [PubMed 16595695]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased weight and increased resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,290,551 (GRCm39) P118S probably damaging Het
Adgrl1 T A 8: 84,656,343 (GRCm39) D215E probably damaging Het
Afap1l2 T C 19: 56,902,914 (GRCm39) D755G probably damaging Het
Akr1c18 T A 13: 4,194,332 (GRCm39) D109V possibly damaging Het
Brdt G A 5: 107,506,752 (GRCm39) R445H probably benign Het
Capn2 C A 1: 182,307,288 (GRCm39) E517* probably null Het
Celsr1 A T 15: 85,863,303 (GRCm39) V1243E possibly damaging Het
Cenpe C G 3: 134,953,096 (GRCm39) probably null Het
Cep135 A G 5: 76,778,817 (GRCm39) E748G probably damaging Het
Cfap119 C A 7: 127,187,159 (GRCm39) V35L probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Col6a1 C A 10: 76,545,743 (GRCm39) A910S unknown Het
Cyp4a14 T A 4: 115,347,156 (GRCm39) probably null Het
Dot1l C T 10: 80,619,378 (GRCm39) R412W probably damaging Het
Dyrk2 T C 10: 118,695,594 (GRCm39) T555A probably benign Het
Foxn3 T C 12: 99,162,587 (GRCm39) N438S probably damaging Het
Gdpd5 T C 7: 99,103,001 (GRCm39) F320S probably damaging Het
Grn A G 11: 102,326,560 (GRCm39) H413R probably damaging Het
Gstm7 A T 3: 107,838,963 (GRCm39) M3K possibly damaging Het
Il17rd A G 14: 26,822,293 (GRCm39) E673G probably damaging Het
Klhl29 T C 12: 5,187,500 (GRCm39) D288G possibly damaging Het
Klk1b11 G A 7: 43,426,421 (GRCm39) A79T probably benign Het
Kmt2a A G 9: 44,719,359 (GRCm39) V3914A unknown Het
Map2k2 T C 10: 80,956,877 (GRCm39) V307A probably benign Het
Mst1r G T 9: 107,784,319 (GRCm39) probably benign Het
Nr3c2 A G 8: 77,937,275 (GRCm39) E834G probably damaging Het
Oga A T 19: 45,764,501 (GRCm39) L213H probably damaging Het
Ogfod3 T G 11: 121,074,362 (GRCm39) probably null Het
Or5b102 A T 19: 13,041,423 (GRCm39) Y216F probably damaging Het
Or8d2 T C 9: 38,759,614 (GRCm39) L68P probably damaging Het
Plscr4 A T 9: 92,364,693 (GRCm39) probably null Het
Pou2f1 A G 1: 165,703,444 (GRCm39) S749P probably damaging Het
Ppp4r3b T G 11: 29,155,701 (GRCm39) L556V possibly damaging Het
Psd4 T G 2: 24,291,108 (GRCm39) probably null Het
Rbbp4 T C 4: 129,228,356 (GRCm39) D33G probably damaging Het
Rif1 T A 2: 51,975,153 (GRCm39) M354K probably damaging Het
Scgb2b7 A G 7: 31,404,454 (GRCm39) probably null Het
Sdc1 A G 12: 8,841,370 (GRCm39) D237G probably benign Het
Sel1l3 T C 5: 53,357,593 (GRCm39) Y133C probably damaging Het
Snx31 A G 15: 36,523,587 (GRCm39) probably null Het
Snx7 A G 3: 117,632,488 (GRCm39) F201S probably damaging Het
Tas2r131 C T 6: 132,934,438 (GRCm39) V124I possibly damaging Het
Tbx20 A T 9: 24,651,581 (GRCm39) probably null Het
Topbp1 A T 9: 103,197,756 (GRCm39) N445I probably damaging Het
Tpx2 T A 2: 152,709,263 (GRCm39) I31K possibly damaging Het
Trpv3 T A 11: 73,179,088 (GRCm39) V499E probably damaging Het
Tshr G A 12: 91,500,743 (GRCm39) W258* probably null Het
Usp32 G T 11: 84,878,107 (GRCm39) D1543E probably damaging Het
Usp39 A G 6: 72,315,521 (GRCm39) probably benign Het
Vac14 T C 8: 111,361,020 (GRCm39) S197P probably damaging Het
Vars2 A G 17: 35,971,835 (GRCm39) S497P probably damaging Het
Zfp462 C A 4: 55,008,637 (GRCm39) P201Q probably benign Het
Zkscan5 A G 5: 145,157,847 (GRCm39) Q783R possibly damaging Het
Other mutations in Rmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rmi1 APN 13 58,557,208 (GRCm39) missense probably damaging 1.00
IGL02304:Rmi1 APN 13 58,557,290 (GRCm39) nonsense probably null
R2046:Rmi1 UTSW 13 58,555,772 (GRCm39) missense probably benign
R2144:Rmi1 UTSW 13 58,555,797 (GRCm39) missense probably damaging 0.99
R4624:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4625:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4626:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4627:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4628:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4629:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R5288:Rmi1 UTSW 13 58,557,280 (GRCm39) missense probably damaging 1.00
R6939:Rmi1 UTSW 13 58,557,169 (GRCm39) missense probably benign
R7337:Rmi1 UTSW 13 58,557,393 (GRCm39) nonsense probably null
R8871:Rmi1 UTSW 13 58,557,156 (GRCm39) missense probably benign 0.04
R9248:Rmi1 UTSW 13 58,556,899 (GRCm39) missense probably benign 0.04
R9268:Rmi1 UTSW 13 58,555,853 (GRCm39) missense probably damaging 0.99
R9269:Rmi1 UTSW 13 58,556,840 (GRCm39) missense probably benign 0.12
R9627:Rmi1 UTSW 13 58,557,366 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTGAACCACACAGCTTTGATTC -3'
(R):5'- GTCACAGTAGTAACTTCCTTTGGC -3'

Sequencing Primer
(F):5'- CACACAGCTTTGATTCATAAACAAGG -3'
(R):5'- GCTTTCTGGCCATTAGAACAGAC -3'
Posted On 2019-11-26