Incidental Mutation 'R7741:Mgea5'
ID596577
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7741 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45776062 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 213 (L213H)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably damaging
Transcript: ENSMUST00000026243
AA Change: L213H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: L213H

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,454,717 P118S probably damaging Het
Adgrl1 T A 8: 83,929,714 D215E probably damaging Het
Afap1l2 T C 19: 56,914,482 D755G probably damaging Het
Akr1c18 T A 13: 4,144,333 D109V possibly damaging Het
Brdt G A 5: 107,358,886 R445H probably benign Het
Capn2 C A 1: 182,479,723 E517* probably null Het
Ccdc189 C A 7: 127,587,987 V35L probably benign Het
Celsr1 A T 15: 85,979,102 V1243E possibly damaging Het
Cenpe C G 3: 135,247,335 probably null Het
Cep135 A G 5: 76,630,970 E748G probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Col6a1 C A 10: 76,709,909 A910S unknown Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Dot1l C T 10: 80,783,544 R412W probably damaging Het
Dyrk2 T C 10: 118,859,689 T555A probably benign Het
Foxn3 T C 12: 99,196,328 N438S probably damaging Het
Gdpd5 T C 7: 99,453,794 F320S probably damaging Het
Grn A G 11: 102,435,734 H413R probably damaging Het
Gstm7 A T 3: 107,931,647 M3K possibly damaging Het
Il17rd A G 14: 27,100,336 E673G probably damaging Het
Klhl29 T C 12: 5,137,500 D288G possibly damaging Het
Klk11 G A 7: 43,776,997 A79T probably benign Het
Kmt2a A G 9: 44,808,062 V3914A unknown Het
Map2k2 T C 10: 81,121,043 V307A probably benign Het
Mst1r G T 9: 107,907,120 probably benign Het
Nr3c2 A G 8: 77,210,646 E834G probably damaging Het
Ogfod3 T G 11: 121,183,536 probably null Het
Olfr1454 A T 19: 13,064,059 Y216F probably damaging Het
Olfr924 T C 9: 38,848,318 L68P probably damaging Het
Plscr4 A T 9: 92,482,640 probably null Het
Pou2f1 A G 1: 165,875,875 S749P probably damaging Het
Ppp4r3b T G 11: 29,205,701 L556V possibly damaging Het
Psd4 T G 2: 24,401,096 probably null Het
Rbbp4 T C 4: 129,334,563 D33G probably damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Rmi1 A G 13: 58,409,253 K439E probably benign Het
Scgb2b7 A G 7: 31,705,029 probably null Het
Sdc1 A G 12: 8,791,370 D237G probably benign Het
Sel1l3 T C 5: 53,200,251 Y133C probably damaging Het
Snx31 A G 15: 36,523,441 probably null Het
Snx7 A G 3: 117,838,839 F201S probably damaging Het
Tas2r131 C T 6: 132,957,475 V124I possibly damaging Het
Tbx20 A T 9: 24,740,285 probably null Het
Topbp1 A T 9: 103,320,557 N445I probably damaging Het
Tpx2 T A 2: 152,867,343 I31K possibly damaging Het
Trpv3 T A 11: 73,288,262 V499E probably damaging Het
Tshr G A 12: 91,533,969 W258* probably null Het
Usp32 G T 11: 84,987,281 D1543E probably damaging Het
Usp39 A G 6: 72,338,538 probably benign Het
Vac14 T C 8: 110,634,388 S197P probably damaging Het
Vars2 A G 17: 35,660,943 S497P probably damaging Het
Zfp462 C A 4: 55,008,637 P201Q probably benign Het
Zkscan5 A G 5: 145,221,037 Q783R possibly damaging Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
R8017:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8019:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8066:Mgea5 UTSW 19 45771852 missense probably damaging 0.99
R8075:Mgea5 UTSW 19 45761182 missense probably damaging 0.97
R8172:Mgea5 UTSW 19 45776900 missense probably damaging 0.99
R8558:Mgea5 UTSW 19 45758072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGAGAATTTGACTTGTTCAAGC -3'
(R):5'- CCCTCTTGAGATAAGCTAGTAATCATG -3'

Sequencing Primer
(F):5'- TTCTGTAACACTGACAATGTCATG -3'
(R):5'- CATGTTGGTTTTCTTTTCTAAGGTC -3'
Posted On2019-11-26