Incidental Mutation 'R7742:Rp1'
ID596579
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7742 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4170234 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 899 (F899I)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: F899I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,757 K417R possibly damaging Het
4930415O20Rik T A 15: 98,585,369 V60E probably damaging Het
Adgrl2 A T 3: 148,836,428 I886N probably damaging Het
Angptl2 A G 2: 33,243,916 T417A probably damaging Het
Ankrd33b T C 15: 31,367,392 M1V probably null Het
Ccdc151 T C 9: 21,992,897 D361G possibly damaging Het
Col3a1 A G 1: 45,345,001 H1155R unknown Het
Csad A G 15: 102,187,164 S153P probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmtf1 C T 5: 9,122,457 probably benign Het
Dna2 T C 10: 62,973,294 I1055T probably benign Het
Dync2h1 T C 9: 7,076,232 D2975G probably benign Het
F5 G T 1: 164,207,884 V1876F possibly damaging Het
Fam81b T A 13: 76,251,690 I150F probably damaging Het
Fbl T A 7: 28,178,259 V252E probably damaging Het
Fbln1 A G 15: 85,240,716 D475G probably damaging Het
Fshr T A 17: 88,986,162 I363F probably benign Het
Gapvd1 A G 2: 34,678,623 L1328P probably damaging Het
Gm5662 A T 12: 88,271,706 Y95N probably damaging Het
Gm8693 C T 7: 22,691,918 V134I probably benign Het
Hcfc2 T A 10: 82,711,825 probably null Het
Ifi209 C A 1: 173,642,632 T262K probably damaging Het
Kif2b T A 11: 91,576,585 I291F possibly damaging Het
Lrp1b T A 2: 40,822,629 D3231V Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nudcd1 T C 15: 44,405,358 K209E probably benign Het
Nup98 C T 7: 102,153,257 probably null Het
Olfr531 T A 7: 140,400,321 I242F probably benign Het
Olfr706 T C 7: 106,886,622 Q65R probably damaging Het
Pign T C 1: 105,552,397 I851V probably benign Het
Pkd1l3 T A 8: 109,614,572 L19Q unknown Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prkcg T C 7: 3,329,943 I627T possibly damaging Het
Prl7b1 A T 13: 27,607,048 M18K probably benign Het
Ptpn3 T A 4: 57,265,092 probably null Het
Sis T A 3: 72,925,098 Y1026F probably benign Het
Slc4a10 T G 2: 62,296,850 V879G probably damaging Het
Specc1l T C 10: 75,246,417 I549T probably benign Het
Sprr2a3 G A 3: 92,288,759 V58M unknown Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Syne2 C T 12: 76,059,435 H785Y probably benign Het
Tat T A 8: 109,991,610 N42K probably benign Het
Tmem184a C T 5: 139,806,989 A271T probably benign Het
Tmprss11d T C 5: 86,303,634 I411V probably damaging Het
Ttn T C 2: 76,903,528 I4468V unknown Het
Vcam1 T C 3: 116,116,085 N531S possibly damaging Het
Wdr78 C T 4: 103,090,433 M215I probably benign Het
Xcl1 T C 1: 164,935,472 T7A unknown Het
Zc3h11a A G 1: 133,637,435 V242A probably benign Het
Zc3h7a A T 16: 11,153,161 Y335N probably benign Het
Zp2 T C 7: 120,132,508 I675V unknown Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATATCTTGCAATCAGGGCAC -3'
(R):5'- TCTGTACAGAAGAAAGCAAGCATC -3'

Sequencing Primer
(F):5'- CTTGCAATCAGGGCACAATATTAAC -3'
(R):5'- CATCTGTGCAGGATTGAGACACTTC -3'
Posted On2019-11-26