Incidental Mutation 'R7742:Dennd1b'
ID596583
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7742 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139062873 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 192 (E192K)
Ref Sequence ENSEMBL: ENSMUSP00000142738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000198759] [ENSMUST00000200429] [ENSMUST00000200533]
Predicted Effect
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: E97K

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198759
Predicted Effect probably damaging
Transcript: ENSMUST00000200429
AA Change: E172K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200533
AA Change: E192K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142738
Gene: ENSMUSG00000056268
AA Change: E192K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 232 4.61e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,757 K417R possibly damaging Het
4930415O20Rik T A 15: 98,585,369 V60E probably damaging Het
Adgrl2 A T 3: 148,836,428 I886N probably damaging Het
Angptl2 A G 2: 33,243,916 T417A probably damaging Het
Ankrd33b T C 15: 31,367,392 M1V probably null Het
Ccdc151 T C 9: 21,992,897 D361G possibly damaging Het
Col3a1 A G 1: 45,345,001 H1155R unknown Het
Csad A G 15: 102,187,164 S153P probably damaging Het
Dmtf1 C T 5: 9,122,457 probably benign Het
Dna2 T C 10: 62,973,294 I1055T probably benign Het
Dync2h1 T C 9: 7,076,232 D2975G probably benign Het
F5 G T 1: 164,207,884 V1876F possibly damaging Het
Fam81b T A 13: 76,251,690 I150F probably damaging Het
Fbl T A 7: 28,178,259 V252E probably damaging Het
Fbln1 A G 15: 85,240,716 D475G probably damaging Het
Fshr T A 17: 88,986,162 I363F probably benign Het
Gapvd1 A G 2: 34,678,623 L1328P probably damaging Het
Gm5662 A T 12: 88,271,706 Y95N probably damaging Het
Gm8693 C T 7: 22,691,918 V134I probably benign Het
Hcfc2 T A 10: 82,711,825 probably null Het
Ifi209 C A 1: 173,642,632 T262K probably damaging Het
Kif2b T A 11: 91,576,585 I291F possibly damaging Het
Lrp1b T A 2: 40,822,629 D3231V Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nudcd1 T C 15: 44,405,358 K209E probably benign Het
Nup98 C T 7: 102,153,257 probably null Het
Olfr531 T A 7: 140,400,321 I242F probably benign Het
Olfr706 T C 7: 106,886,622 Q65R probably damaging Het
Pign T C 1: 105,552,397 I851V probably benign Het
Pkd1l3 T A 8: 109,614,572 L19Q unknown Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prkcg T C 7: 3,329,943 I627T possibly damaging Het
Prl7b1 A T 13: 27,607,048 M18K probably benign Het
Ptpn3 T A 4: 57,265,092 probably null Het
Rp1 A T 1: 4,170,234 F899I unknown Het
Sis T A 3: 72,925,098 Y1026F probably benign Het
Slc4a10 T G 2: 62,296,850 V879G probably damaging Het
Specc1l T C 10: 75,246,417 I549T probably benign Het
Sprr2a3 G A 3: 92,288,759 V58M unknown Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Syne2 C T 12: 76,059,435 H785Y probably benign Het
Tat T A 8: 109,991,610 N42K probably benign Het
Tmem184a C T 5: 139,806,989 A271T probably benign Het
Tmprss11d T C 5: 86,303,634 I411V probably damaging Het
Ttn T C 2: 76,903,528 I4468V unknown Het
Vcam1 T C 3: 116,116,085 N531S possibly damaging Het
Wdr78 C T 4: 103,090,433 M215I probably benign Het
Xcl1 T C 1: 164,935,472 T7A unknown Het
Zc3h11a A G 1: 133,637,435 V242A probably benign Het
Zc3h7a A T 16: 11,153,161 Y335N probably benign Het
Zp2 T C 7: 120,132,508 I675V unknown Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 intron probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7796:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7871:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7954:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R8025:Dennd1b UTSW 1 139110420 missense
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATTGGGTACAAAAGATGG -3'
(R):5'- TAAATGTGCAGACGTGTTTAGGTC -3'

Sequencing Primer
(F):5'- AGATGGTATTATTAGAAGTGGCATTC -3'
(R):5'- GGTCTTTTTGTGAAGCACTCAATATG -3'
Posted On2019-11-26