Incidental Mutation 'R7742:Zp2'
ID596605
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Namezona pellucida glycoprotein 2
SynonymsZp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7742 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120126772-120145291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120132508 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 675 (I675V)
Ref Sequence ENSEMBL: ENSMUSP00000033207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
Predicted Effect unknown
Transcript: ENSMUST00000033207
AA Change: I675V
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: I675V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207726
Predicted Effect probably benign
Transcript: ENSMUST00000208874
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,662,757 K417R possibly damaging Het
4930415O20Rik T A 15: 98,585,369 V60E probably damaging Het
Adgrl2 A T 3: 148,836,428 I886N probably damaging Het
Angptl2 A G 2: 33,243,916 T417A probably damaging Het
Ankrd33b T C 15: 31,367,392 M1V probably null Het
Ccdc151 T C 9: 21,992,897 D361G possibly damaging Het
Col3a1 A G 1: 45,345,001 H1155R unknown Het
Csad A G 15: 102,187,164 S153P probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmtf1 C T 5: 9,122,457 probably benign Het
Dna2 T C 10: 62,973,294 I1055T probably benign Het
Dync2h1 T C 9: 7,076,232 D2975G probably benign Het
F5 G T 1: 164,207,884 V1876F possibly damaging Het
Fam81b T A 13: 76,251,690 I150F probably damaging Het
Fbl T A 7: 28,178,259 V252E probably damaging Het
Fbln1 A G 15: 85,240,716 D475G probably damaging Het
Fshr T A 17: 88,986,162 I363F probably benign Het
Gapvd1 A G 2: 34,678,623 L1328P probably damaging Het
Gm5662 A T 12: 88,271,706 Y95N probably damaging Het
Gm8693 C T 7: 22,691,918 V134I probably benign Het
Hcfc2 T A 10: 82,711,825 probably null Het
Ifi209 C A 1: 173,642,632 T262K probably damaging Het
Kif2b T A 11: 91,576,585 I291F possibly damaging Het
Lrp1b T A 2: 40,822,629 D3231V Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nudcd1 T C 15: 44,405,358 K209E probably benign Het
Nup98 C T 7: 102,153,257 probably null Het
Olfr531 T A 7: 140,400,321 I242F probably benign Het
Olfr706 T C 7: 106,886,622 Q65R probably damaging Het
Pign T C 1: 105,552,397 I851V probably benign Het
Pkd1l3 T A 8: 109,614,572 L19Q unknown Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prkcg T C 7: 3,329,943 I627T possibly damaging Het
Prl7b1 A T 13: 27,607,048 M18K probably benign Het
Ptpn3 T A 4: 57,265,092 probably null Het
Rp1 A T 1: 4,170,234 F899I unknown Het
Sis T A 3: 72,925,098 Y1026F probably benign Het
Slc4a10 T G 2: 62,296,850 V879G probably damaging Het
Specc1l T C 10: 75,246,417 I549T probably benign Het
Sprr2a3 G A 3: 92,288,759 V58M unknown Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Syne2 C T 12: 76,059,435 H785Y probably benign Het
Tat T A 8: 109,991,610 N42K probably benign Het
Tmem184a C T 5: 139,806,989 A271T probably benign Het
Tmprss11d T C 5: 86,303,634 I411V probably damaging Het
Ttn T C 2: 76,903,528 I4468V unknown Het
Vcam1 T C 3: 116,116,085 N531S possibly damaging Het
Wdr78 C T 4: 103,090,433 M215I probably benign Het
Xcl1 T C 1: 164,935,472 T7A unknown Het
Zc3h11a A G 1: 133,637,435 V242A probably benign Het
Zc3h7a A T 16: 11,153,161 Y335N probably benign Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 120133400 missense probably benign 0.00
IGL00707:Zp2 APN 7 120133413 missense probably benign 0.03
IGL00916:Zp2 APN 7 120138174 missense probably damaging 1.00
IGL01554:Zp2 APN 7 120138325 missense possibly damaging 0.78
IGL01845:Zp2 APN 7 120138191 missense probably damaging 1.00
IGL02111:Zp2 APN 7 120132418 missense possibly damaging 0.75
IGL02145:Zp2 APN 7 120139851 critical splice acceptor site probably null
IGL02155:Zp2 APN 7 120144117 missense probably benign 0.00
IGL02178:Zp2 APN 7 120133750 missense possibly damaging 0.85
IGL02646:Zp2 APN 7 120135341 missense possibly damaging 0.92
IGL03220:Zp2 APN 7 120137227 missense possibly damaging 0.90
PIT4687001:Zp2 UTSW 7 120141879 missense probably benign 0.00
R0138:Zp2 UTSW 7 120137200 missense probably damaging 0.96
R0197:Zp2 UTSW 7 120143576 splice site probably benign
R0519:Zp2 UTSW 7 120138149 missense probably damaging 1.00
R0573:Zp2 UTSW 7 120135470 splice site probably benign
R0879:Zp2 UTSW 7 120135534 missense probably damaging 1.00
R0883:Zp2 UTSW 7 120143576 splice site probably benign
R1160:Zp2 UTSW 7 120136045 missense probably damaging 1.00
R1235:Zp2 UTSW 7 120138343 missense possibly damaging 0.57
R1753:Zp2 UTSW 7 120138105 missense probably benign
R1883:Zp2 UTSW 7 120133401 missense probably benign 0.02
R1995:Zp2 UTSW 7 120135165 missense probably damaging 0.97
R2196:Zp2 UTSW 7 120138306 missense probably benign
R2850:Zp2 UTSW 7 120138306 missense probably benign
R3715:Zp2 UTSW 7 120141834 missense possibly damaging 0.95
R3931:Zp2 UTSW 7 120132357 intron probably benign
R4082:Zp2 UTSW 7 120135252 missense probably benign 0.01
R4731:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4732:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4733:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4754:Zp2 UTSW 7 120138318 missense probably benign 0.01
R4863:Zp2 UTSW 7 120135772 missense probably damaging 1.00
R5274:Zp2 UTSW 7 120138092 missense possibly damaging 0.92
R5392:Zp2 UTSW 7 120135764 nonsense probably null
R5877:Zp2 UTSW 7 120133339 missense probably null 0.94
R6390:Zp2 UTSW 7 120141230 missense probably benign 0.23
R6404:Zp2 UTSW 7 120135542 missense possibly damaging 0.73
R6546:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120141913 missense probably benign
R6707:Zp2 UTSW 7 120133922 missense possibly damaging 0.85
R7274:Zp2 UTSW 7 120132391 makesense probably null
R7275:Zp2 UTSW 7 120135353 splice site probably null
R7541:Zp2 UTSW 7 120136056 missense probably damaging 1.00
R7585:Zp2 UTSW 7 120133944 missense probably damaging 1.00
R7709:Zp2 UTSW 7 120135775 missense probably damaging 1.00
R7767:Zp2 UTSW 7 120137169 missense probably benign 0.01
R7771:Zp2 UTSW 7 120143642 missense probably damaging 0.96
R8391:Zp2 UTSW 7 120126956 missense probably benign 0.00
X0017:Zp2 UTSW 7 120133385 missense probably damaging 1.00
X0023:Zp2 UTSW 7 120133367 missense probably damaging 1.00
Z1176:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAAGGATTGTGAACAGG -3'
(R):5'- CCAATCTGGCTTGAGATGGG -3'

Sequencing Primer
(F):5'- TCAGCCAGAAAGTGCTTGTC -3'
(R):5'- TCTGGCTTGAGATGGGAAGAGC -3'
Posted On2019-11-26