Incidental Mutation 'R7742:3425401B19Rik'
ID596622
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7742 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32662757 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 417 (K417R)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096038
AA Change: K417R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: K417R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T A 15: 98,585,369 V60E probably damaging Het
Adgrl2 A T 3: 148,836,428 I886N probably damaging Het
Angptl2 A G 2: 33,243,916 T417A probably damaging Het
Ankrd33b T C 15: 31,367,392 M1V probably null Het
Ccdc151 T C 9: 21,992,897 D361G possibly damaging Het
Col3a1 A G 1: 45,345,001 H1155R unknown Het
Csad A G 15: 102,187,164 S153P probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmtf1 C T 5: 9,122,457 probably benign Het
Dna2 T C 10: 62,973,294 I1055T probably benign Het
Dync2h1 T C 9: 7,076,232 D2975G probably benign Het
F5 G T 1: 164,207,884 V1876F possibly damaging Het
Fam81b T A 13: 76,251,690 I150F probably damaging Het
Fbl T A 7: 28,178,259 V252E probably damaging Het
Fbln1 A G 15: 85,240,716 D475G probably damaging Het
Fshr T A 17: 88,986,162 I363F probably benign Het
Gapvd1 A G 2: 34,678,623 L1328P probably damaging Het
Gm5662 A T 12: 88,271,706 Y95N probably damaging Het
Gm8693 C T 7: 22,691,918 V134I probably benign Het
Hcfc2 T A 10: 82,711,825 probably null Het
Ifi209 C A 1: 173,642,632 T262K probably damaging Het
Kif2b T A 11: 91,576,585 I291F possibly damaging Het
Lrp1b T A 2: 40,822,629 D3231V Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nudcd1 T C 15: 44,405,358 K209E probably benign Het
Nup98 C T 7: 102,153,257 probably null Het
Olfr531 T A 7: 140,400,321 I242F probably benign Het
Olfr706 T C 7: 106,886,622 Q65R probably damaging Het
Pign T C 1: 105,552,397 I851V probably benign Het
Pkd1l3 T A 8: 109,614,572 L19Q unknown Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prkcg T C 7: 3,329,943 I627T possibly damaging Het
Prl7b1 A T 13: 27,607,048 M18K probably benign Het
Ptpn3 T A 4: 57,265,092 probably null Het
Rp1 A T 1: 4,170,234 F899I unknown Het
Sis T A 3: 72,925,098 Y1026F probably benign Het
Slc4a10 T G 2: 62,296,850 V879G probably damaging Het
Specc1l T C 10: 75,246,417 I549T probably benign Het
Sprr2a3 G A 3: 92,288,759 V58M unknown Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Syne2 C T 12: 76,059,435 H785Y probably benign Het
Tat T A 8: 109,991,610 N42K probably benign Het
Tmem184a C T 5: 139,806,989 A271T probably benign Het
Tmprss11d T C 5: 86,303,634 I411V probably damaging Het
Ttn T C 2: 76,903,528 I4468V unknown Het
Vcam1 T C 3: 116,116,085 N531S possibly damaging Het
Wdr78 C T 4: 103,090,433 M215I probably benign Het
Xcl1 T C 1: 164,935,472 T7A unknown Het
Zc3h11a A G 1: 133,637,435 V242A probably benign Het
Zc3h7a A T 16: 11,153,161 Y335N probably benign Het
Zp2 T C 7: 120,132,508 I675V unknown Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCTATCCCGAGACTGAGC -3'
(R):5'- TCCCAGCTATTCCCTGTAGAG -3'

Sequencing Primer
(F):5'- AGACTGAGCCTCACTGGACTC -3'
(R):5'- CCTGTAGAGGGGAATGCTTCAC -3'
Posted On2019-11-26