Incidental Mutation 'R7743:Erbb4'
ID596631
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7743 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68328119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 480 (T480A)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: T480A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: T480A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: T480A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: T480A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
AA Change: T480A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: T480A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,755 E1235G probably damaging Het
Adam6a A G 12: 113,544,532 D175G probably benign Het
Adgrf4 A T 17: 42,672,562 C76* probably null Het
Agbl3 C T 6: 34,846,830 T815I probably damaging Het
Ahnak2 A G 12: 112,784,763 V488A not run Het
Akip1 T A 7: 109,711,828 S192T probably benign Het
Apc2 G A 10: 80,304,915 M201I probably damaging Het
Arel1 G T 12: 84,940,269 N124K probably damaging Het
Atp10a A T 7: 58,803,709 H845L probably damaging Het
Atp2a2 A G 5: 122,461,571 Y586H probably benign Het
BC051019 A G 7: 109,716,059 Y330H probably damaging Het
Btbd11 A T 10: 85,624,949 I569F possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chek2 T G 5: 110,840,050 probably null Het
Cldn14 A G 16: 93,919,727 L77S probably damaging Het
Cox15 T C 19: 43,739,941 K298E possibly damaging Het
Cpt1b G T 15: 89,421,404 D369E probably benign Het
Cpxm1 T C 2: 130,393,422 N550S probably benign Het
Csdc2 A G 15: 81,949,198 E132G possibly damaging Het
Cyb5d2 A T 11: 72,778,876 C219S probably damaging Het
Fndc1 G A 17: 7,765,137 T1319I unknown Het
Gm5773 T G 3: 93,773,258 V79G probably damaging Het
Hsf2 G A 10: 57,511,335 probably null Het
Itgb2l T C 16: 96,437,408 T64A probably damaging Het
Kifc5b T C 17: 26,924,202 V316A probably damaging Het
Ktn1 A G 14: 47,670,293 D279G probably damaging Het
Lonrf1 T C 8: 36,249,052 E143G possibly damaging Het
Mroh9 C T 1: 163,024,553 E856K probably benign Het
Muc16 T C 9: 18,657,477 T1249A unknown Het
Myh6 G A 14: 54,957,150 R721W probably damaging Het
Myo6 A T 9: 80,276,329 I669F unknown Het
N4bp2 A G 5: 65,808,459 T1284A probably damaging Het
Npr3 A G 15: 11,905,638 M1T probably null Het
Obscn C T 11: 59,099,777 V1657M probably damaging Het
Olfr243 A G 7: 103,717,353 E253G possibly damaging Het
Olfr551 A T 7: 102,588,431 F104Y probably benign Het
Olfr908 A G 9: 38,516,328 T99A possibly damaging Het
Otud6b C A 4: 14,818,389 A171S possibly damaging Het
Pdcd2l A C 7: 34,192,831 D204E probably benign Het
Pdia2 T C 17: 26,198,868 S56G probably benign Het
Plcxd1 G A 5: 110,102,503 E237K possibly damaging Het
Plekha5 A T 6: 140,555,986 R633S probably damaging Het
Pnpla6 T C 8: 3,536,594 F937L possibly damaging Het
Pth2 A T 7: 45,181,309 M6L probably benign Het
Ptprd T A 4: 76,086,089 K143I probably damaging Het
Rhbdf2 T C 11: 116,601,601 D487G probably benign Het
Rhbdf2 A T 11: 116,603,949 D300E probably benign Het
Rock2 G A 12: 16,976,047 V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,579,932 probably benign Het
Rtn4 T A 11: 29,733,790 Y1027* probably null Het
Rxfp3 A G 15: 11,037,130 L52P probably damaging Het
Sel1l3 A G 5: 53,135,885 Y830H probably benign Het
Serpinb3d C T 1: 107,079,358 V207I probably damaging Het
Sipa1l2 T C 8: 125,464,233 E1006G probably damaging Het
Slc22a19 C T 19: 7,683,836 M324I possibly damaging Het
Slc37a1 T A 17: 31,316,185 F106I probably damaging Het
Snx14 A T 9: 88,398,349 S518T probably benign Het
Sp2 T C 11: 96,961,109 T330A probably damaging Het
Spata13 A T 14: 60,756,249 H1050L probably damaging Het
Sptssa A C 12: 54,656,416 V23G possibly damaging Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tars A C 15: 11,399,372 probably null Het
Tead3 T A 17: 28,332,827 T431S probably benign Het
Tiam2 G A 17: 3,518,156 E1526K possibly damaging Het
Tnni3 G A 7: 4,521,892 P12L probably benign Het
Topaz1 A G 9: 122,785,136 H1207R probably benign Het
Trdn G T 10: 33,257,062 E107* probably null Het
Trp63 A G 16: 25,882,625 N483S probably benign Het
Trpm4 A G 7: 45,308,338 S1009P probably benign Het
Trpm6 T C 19: 18,827,408 V908A probably benign Het
Tsen34 A T 7: 3,694,602 M25L possibly damaging Het
Ttn T C 2: 76,951,483 E1073G unknown Het
Uaca A T 9: 60,876,395 I1380F probably damaging Het
Ubr3 A G 2: 69,944,449 T539A probably benign Het
Ugt1a5 T A 1: 88,166,395 M115K probably benign Het
Unc45b A T 11: 82,922,900 I378F probably damaging Het
Unk G A 11: 116,049,436 R205Q possibly damaging Het
Ush2a T A 1: 188,810,179 L3314Q probably benign Het
Vezt A G 10: 93,980,424 L475P probably damaging Het
Vmn2r115 C T 17: 23,345,798 Q220* probably null Het
Yap1 T C 9: 7,962,378 Q223R probably benign Het
Zdhhc7 G A 8: 120,086,728 T114M possibly damaging Het
Zwilch A C 9: 64,152,935 C374G probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATTGGCCAGAATGTGAAGAC -3'
(R):5'- AGGTCCCGAATTATGCATTTTCC -3'

Sequencing Primer
(F):5'- CCAGAATGTGAAGACAGACTATATTC -3'
(R):5'- GTCCCGAATTATGCATTTTCCATTTC -3'
Posted On2019-11-26