Incidental Mutation 'R0067:Skiv2l2'
ID59664
Institutional Source Beutler Lab
Gene Symbol Skiv2l2
Ensembl Gene ENSMUSG00000016018
Gene Namesuperkiller viralicidic activity 2-like 2 (S. cerevisiae)
Synonyms2610528A15Rik
MMRRC Submission 038358-MU
Accession Numbers

Ncbi RefSeq: NM_028151.2; MGI:1919448

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0067 (G1)
Quality Score203
Status Validated
Chromosome13
Chromosomal Location112867418-112927398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112886862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 727 (V727I)
Ref Sequence ENSEMBL: ENSMUSP00000022281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022281]
Predicted Effect probably benign
Transcript: ENSMUST00000022281
AA Change: V727I

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022281
Gene: ENSMUSG00000016018
AA Change: V727I

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DEXDc 134 317 6.42e-34 SMART
HELICc 437 526 3.14e-19 SMART
Pfam:rRNA_proc-arch 580 839 1.7e-91 PFAM
DSHCT 863 1040 1.69e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182295
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Pbk G A 14: 65,815,226 V173I possibly damaging Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Scamp1 T C 13: 94,204,150 Y237C probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Ticrr A T 7: 79,677,410 D622V probably damaging Het
Tie1 A G 4: 118,476,280 probably benign Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Unc79 A G 12: 103,059,518 E388G probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Skiv2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Skiv2l2 APN 13 112914489 missense probably damaging 1.00
IGL01772:Skiv2l2 APN 13 112891325 missense probably benign 0.10
IGL01843:Skiv2l2 APN 13 112918561 splice site probably benign
IGL01972:Skiv2l2 APN 13 112881061 missense probably damaging 1.00
IGL02451:Skiv2l2 APN 13 112891347 missense probably damaging 1.00
IGL02716:Skiv2l2 APN 13 112883146 missense probably benign 0.13
IGL03234:Skiv2l2 APN 13 112880975 splice site probably benign
K3955:Skiv2l2 UTSW 13 112910979 nonsense probably null
P0038:Skiv2l2 UTSW 13 112910979 nonsense probably null
R0067:Skiv2l2 UTSW 13 112886862 missense probably benign 0.34
R0086:Skiv2l2 UTSW 13 112927328 missense probably benign 0.00
R0687:Skiv2l2 UTSW 13 112914361 missense probably damaging 1.00
R1216:Skiv2l2 UTSW 13 112914342 splice site probably benign
R1218:Skiv2l2 UTSW 13 112917622 missense probably damaging 1.00
R1312:Skiv2l2 UTSW 13 112883251 nonsense probably null
R1827:Skiv2l2 UTSW 13 112913099 critical splice donor site probably null
R1852:Skiv2l2 UTSW 13 112872927 missense probably benign 0.00
R1889:Skiv2l2 UTSW 13 112887490 missense probably benign 0.00
R2205:Skiv2l2 UTSW 13 112898890 missense probably benign 0.06
R2256:Skiv2l2 UTSW 13 112876512 missense probably damaging 0.98
R2394:Skiv2l2 UTSW 13 112883168 missense probably benign 0.02
R3717:Skiv2l2 UTSW 13 112895595 missense probably damaging 1.00
R3779:Skiv2l2 UTSW 13 112903392 splice site probably benign
R4613:Skiv2l2 UTSW 13 112921739 nonsense probably null
R4939:Skiv2l2 UTSW 13 112909892 missense possibly damaging 0.91
R5452:Skiv2l2 UTSW 13 112913181 missense probably null 0.96
R5591:Skiv2l2 UTSW 13 112927356 start codon destroyed probably null 0.88
R5688:Skiv2l2 UTSW 13 112873056 nonsense probably null
R5761:Skiv2l2 UTSW 13 112917662 missense probably damaging 0.96
R5789:Skiv2l2 UTSW 13 112891285 missense probably benign 0.01
R5851:Skiv2l2 UTSW 13 112908952 missense probably damaging 1.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6038:Skiv2l2 UTSW 13 112891290 missense probably benign 0.00
R6348:Skiv2l2 UTSW 13 112910917 missense possibly damaging 0.88
R7276:Skiv2l2 UTSW 13 112914439 missense probably benign 0.00
R7397:Skiv2l2 UTSW 13 112921686 missense probably benign
R7792:Skiv2l2 UTSW 13 112872909 missense probably benign 0.02
R7863:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7946:Skiv2l2 UTSW 13 112908901 missense probably benign 0.00
R7948:Skiv2l2 UTSW 13 112921762 missense probably benign 0.02
R8035:Skiv2l2 UTSW 13 112898802 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CGATTAATGCTGCTGCACTCAGAAC -3'
(R):5'- CGAAGTCATCTCAAGTCTCAGGCG -3'

Sequencing Primer
(F):5'- GCTGCTGCACTCAGAACATATC -3'
(R):5'- CGAGTCTCACCTGGATGTG -3'
Posted On2013-07-11