Incidental Mutation 'R7743:Sel1l3'
ID596643
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7743 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53135885 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 830 (Y830H)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably benign
Transcript: ENSMUST00000031090
AA Change: Y830H

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: Y830H

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,755 E1235G probably damaging Het
Adam6a A G 12: 113,544,532 D175G probably benign Het
Adgrf4 A T 17: 42,672,562 C76* probably null Het
Agbl3 C T 6: 34,846,830 T815I probably damaging Het
Ahnak2 A G 12: 112,784,763 V488A not run Het
Akip1 T A 7: 109,711,828 S192T probably benign Het
Apc2 G A 10: 80,304,915 M201I probably damaging Het
Arel1 G T 12: 84,940,269 N124K probably damaging Het
Atp10a A T 7: 58,803,709 H845L probably damaging Het
Atp2a2 A G 5: 122,461,571 Y586H probably benign Het
BC051019 A G 7: 109,716,059 Y330H probably damaging Het
Btbd11 A T 10: 85,624,949 I569F possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chek2 T G 5: 110,840,050 probably null Het
Cldn14 A G 16: 93,919,727 L77S probably damaging Het
Cox15 T C 19: 43,739,941 K298E possibly damaging Het
Cpt1b G T 15: 89,421,404 D369E probably benign Het
Cpxm1 T C 2: 130,393,422 N550S probably benign Het
Csdc2 A G 15: 81,949,198 E132G possibly damaging Het
Cyb5d2 A T 11: 72,778,876 C219S probably damaging Het
Erbb4 T C 1: 68,328,119 T480A probably benign Het
Fndc1 G A 17: 7,765,137 T1319I unknown Het
Gm5773 T G 3: 93,773,258 V79G probably damaging Het
Itgb2l T C 16: 96,437,408 T64A probably damaging Het
Kifc5b T C 17: 26,924,202 V316A probably damaging Het
Ktn1 A G 14: 47,670,293 D279G probably damaging Het
Lonrf1 T C 8: 36,249,052 E143G possibly damaging Het
Mroh9 C T 1: 163,024,553 E856K probably benign Het
Muc16 T C 9: 18,657,477 T1249A unknown Het
Myh6 G A 14: 54,957,150 R721W probably damaging Het
Myo6 A T 9: 80,276,329 I669F unknown Het
N4bp2 A G 5: 65,808,459 T1284A probably damaging Het
Npr3 A G 15: 11,905,638 M1T probably null Het
Obscn C T 11: 59,099,777 V1657M probably damaging Het
Olfr243 A G 7: 103,717,353 E253G possibly damaging Het
Olfr551 A T 7: 102,588,431 F104Y probably benign Het
Olfr908 A G 9: 38,516,328 T99A possibly damaging Het
Otud6b C A 4: 14,818,389 A171S possibly damaging Het
Pdcd2l A C 7: 34,192,831 D204E probably benign Het
Pdia2 T C 17: 26,198,868 S56G probably benign Het
Plcxd1 G A 5: 110,102,503 E237K possibly damaging Het
Plekha5 A T 6: 140,555,986 R633S probably damaging Het
Pnpla6 T C 8: 3,536,594 F937L possibly damaging Het
Pth2 A T 7: 45,181,309 M6L probably benign Het
Ptprd T A 4: 76,086,089 K143I probably damaging Het
Rhbdf2 T C 11: 116,601,601 D487G probably benign Het
Rhbdf2 A T 11: 116,603,949 D300E probably benign Het
Rock2 G A 12: 16,976,047 V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,579,932 probably benign Het
Rtn4 T A 11: 29,733,790 Y1027* probably null Het
Rxfp3 A G 15: 11,037,130 L52P probably damaging Het
Serpinb3d C T 1: 107,079,358 V207I probably damaging Het
Sipa1l2 T C 8: 125,464,233 E1006G probably damaging Het
Slc22a19 C T 19: 7,683,836 M324I possibly damaging Het
Slc37a1 T A 17: 31,316,185 F106I probably damaging Het
Snx14 A T 9: 88,398,349 S518T probably benign Het
Sp2 T C 11: 96,961,109 T330A probably damaging Het
Spata13 A T 14: 60,756,249 H1050L probably damaging Het
Sptssa A C 12: 54,656,416 V23G possibly damaging Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tead3 T A 17: 28,332,827 T431S probably benign Het
Tiam2 G A 17: 3,518,156 E1526K possibly damaging Het
Tnni3 G A 7: 4,521,892 P12L probably benign Het
Topaz1 A G 9: 122,785,136 H1207R probably benign Het
Trdn G T 10: 33,257,062 E107* probably null Het
Trp63 A G 16: 25,882,625 N483S probably benign Het
Trpm4 A G 7: 45,308,338 S1009P probably benign Het
Trpm6 T C 19: 18,827,408 V908A probably benign Het
Tsen34 A T 7: 3,694,602 M25L possibly damaging Het
Ttn T C 2: 76,951,483 E1073G unknown Het
Uaca A T 9: 60,876,395 I1380F probably damaging Het
Ubr3 A G 2: 69,944,449 T539A probably benign Het
Ugt1a5 T A 1: 88,166,395 M115K probably benign Het
Unc45b A T 11: 82,922,900 I378F probably damaging Het
Unk G A 11: 116,049,436 R205Q possibly damaging Het
Ush2a T A 1: 188,810,179 L3314Q probably benign Het
Vezt A G 10: 93,980,424 L475P probably damaging Het
Vmn2r115 C T 17: 23,345,798 Q220* probably null Het
Yap1 T C 9: 7,962,378 Q223R probably benign Het
Zdhhc7 G A 8: 120,086,728 T114M possibly damaging Het
Zwilch A C 9: 64,152,935 C374G probably damaging Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTTTATTAGACAAGGTGAACAGAGG -3'
(R):5'- TGGAGACGTCTTATATCCTGGG -3'

Sequencing Primer
(F):5'- GACATAGGTTCTCGCTGGAAG -3'
(R):5'- ATATCCTGGGCCTCTGGG -3'
Posted On2019-11-26